Stem-loop sequence oar-mir-495

AccessionMI0016930 (change log)
DescriptionOvis aries miR-495 stem-loop
Gene family MIPF0000110; mir-329
Literature search

1 open access papers mention oar-mir-495
(1 sentences)

Stem-loop
   gcacauccgugc  auca g     ccgc  gu   u          c  -       cu     - uug 
5'             cc    g gcuga    ug  acc gagaagaagu gc ccauguu  uuucg c   a
               ||    | |||||    ||  ||| |||||||||| || |||||||  ||||| |   u
3'             gg    c cgacu    ac  ugg uuuuucuuca cg gguacaa  aaagc g   u
   -----------g  ---g g     cuaa  ug   c          -  u       ac     u ugu 
Get sequence
Deep sequencing
1578 reads, 231 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64532840-64532965 [+]
intergenic
Clustered miRNAs
< 10kb from oar-mir-495
oar-mir-299chr18: 64523015-64523075 [+]
oar-mir-380chr18: 64524198-64524300 [+]
oar-mir-411bchr18: 64524359-64524459 [+]
oar-mir-1197chr18: 64524697-64524825 [+]
oar-mir-323achr18: 64524877-64524977 [+]
oar-mir-758chr18: 64525175-64525274 [+]
oar-mir-329bchr18: 64525872-64525995 [+]
oar-mir-329achr18: 64526187-64526290 [+]
oar-mir-494chr18: 64529077-64529173 [+]
oar-mir-1193chr18: 64529620-64529722 [+]
oar-mir-543chr18: 64531404-64531526 [+]
oar-mir-495chr18: 64532840-64532965 [+]
oar-mir-3958chr18: 64534803-64534906 [+]
oar-mir-376echr18: 64537482-64537587 [+]
oar-mir-376cchr18: 64537853-64537957 [+]
oar-mir-376dchr18: 64538218-64538327 [+]
oar-mir-654chr18: 64538374-64538478 [+]
oar-mir-376bchr18: 64538600-64538705 [+]
oar-mir-376achr18: 64538968-64539070 [+]
oar-mir-1185chr18: 64540919-64541024 [+]
oar-mir-3956chr18: 64541653-64541781 [+]
oar-mir-381chr18: 64542580-64542707 [+]
Database links

Mature sequence oar-miR-495-5p

Accession MIMAT0019273
Sequence

42 - 

agaagucgcccauguucuuuucg

 - 64

Get sequence
Deep sequencing85 reads, 11 experiments
Evidence experimental; Illumina [1]

Mature sequence oar-miR-495-3p

Accession MIMAT0019274
Sequence

79 - 

aaacaaacauggugcacuucuu

 - 100

Get sequence
Deep sequencing1446 reads, 13 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20944086 "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing" Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D Genome Res. 20:1651-1662(2010).