Stem-loop sequence oar-mir-329a

AccessionMI0016926 (change log)
DescriptionOvis aries miR-329a stem-loop
Gene family MIPF0000110; mir-329
Literature search

6 open access papers mention oar-mir-329a
(16 sentences)

Stem-loop
   uguaauu     -------    u           uu      cucc     u   a 
5'        ggugg       uacu gaggagagguu  cuaggu    guuuc uuc u
          |||||       |||| |||||||||||  ||||||    ||||| |||  
3'        ccacc       auga cuuuuuuccaa  ggucca    caaag agg g
   ---gguu     cuagacu    c           uu      --ca     u   a 
Get sequence
Deep sequencing
2127 reads, 369 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64526187-64526290 [+]
intergenic
Clustered miRNAs
< 10kb from oar-mir-329a
oar-mir-379chr18: 64521250-64521374 [+]
oar-mir-411achr18: 64522514-64522638 [+]
oar-mir-299chr18: 64523015-64523075 [+]
oar-mir-380chr18: 64524198-64524300 [+]
oar-mir-411bchr18: 64524359-64524459 [+]
oar-mir-1197chr18: 64524697-64524825 [+]
oar-mir-323achr18: 64524877-64524977 [+]
oar-mir-758chr18: 64525175-64525274 [+]
oar-mir-329bchr18: 64525872-64525995 [+]
oar-mir-329achr18: 64526187-64526290 [+]
oar-mir-494chr18: 64529077-64529173 [+]
oar-mir-1193chr18: 64529620-64529722 [+]
oar-mir-543chr18: 64531404-64531526 [+]
oar-mir-495chr18: 64532840-64532965 [+]
oar-mir-3958chr18: 64534803-64534906 [+]
Database links

Mature sequence oar-miR-329a-5p

Accession MIMAT0019265
Sequence

23 - 

gagguuuucuaggucuccguuu

 - 44

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence oar-miR-329a-3p

Accession MIMAT0019266
Sequence

60 - 

aacacaccugguuaaccuuuuu

 - 81

Get sequence
Deep sequencing2119 reads, 13 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20944086 "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing" Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D Genome Res. 20:1651-1662(2010).