Stem-loop sequence oar-mir-758

AccessionMI0016924 (change log)
DescriptionOvis aries miR-758 stem-loop
Gene family MIPF0000126; mir-379
Stem-loop
   ---cacgugcc       a     --    u      agag    c  uu  u 
5'            uggguac ugagg  uggu gaccag    caca gc  ca u
              ||||||| |||||  |||| ||||||    |||| ||  ||  
3'            aucuaug acucc  auca cugguc    gugu ug  gu u
   guucuccccua       -     ca    c      --ca    u  cc  g 
Get sequence
Deep sequencing
535 reads, 38.5 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64525175-64525274 [+]
intergenic
Clustered miRNAs
< 10kb from oar-mir-758
oar-mir-379chr18: 64521250-64521374 [+]
oar-mir-411achr18: 64522514-64522638 [+]
oar-mir-299chr18: 64523015-64523075 [+]
oar-mir-380chr18: 64524198-64524300 [+]
oar-mir-411bchr18: 64524359-64524459 [+]
oar-mir-1197chr18: 64524697-64524825 [+]
oar-mir-323achr18: 64524877-64524977 [+]
oar-mir-758chr18: 64525175-64525274 [+]
oar-mir-329bchr18: 64525872-64525995 [+]
oar-mir-329achr18: 64526187-64526290 [+]
oar-mir-494chr18: 64529077-64529173 [+]
oar-mir-1193chr18: 64529620-64529722 [+]
oar-mir-543chr18: 64531404-64531526 [+]
oar-mir-495chr18: 64532840-64532965 [+]
oar-mir-3958chr18: 64534803-64534906 [+]
Database links

Mature sequence oar-miR-758-5p

Accession MIMAT0019261
Sequence

22 - 

ugguugaccagagagcacacg

 - 42

Get sequence
Deep sequencing50 reads, 10 experiments
Evidence experimental; Illumina [1]

Mature sequence oar-miR-758-3p

Accession MIMAT0019262
Sequence

57 - 

uuugugaccugguccacuaa

 - 76

Get sequence
Deep sequencing482 reads, 13 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20944086 "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing" Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D Genome Res. 20:1651-1662(2010).