Stem-loop sequence oar-mir-1197

AccessionMI0016922 (change log)
DescriptionOvis aries miR-1197 stem-loop
Gene family MIPF0000126; mir-379
Literature search

1 open access papers mention oar-mir-1197
(3 sentences)

   -gaggcgaggucggcaucccuucc       -u     cgc   u       gug g    - uuu 
5'                         ugguauu  gaaga   ggu gaccaug   u uacg c   a
                           |||||||  |||||   ||| |||||||   | |||| |   u
3'                         acuauag  cuucu   uca cugguac   g augc g   u
   ccuuccagaagguuccgcuucuac       cu     ---   u       aca g    a uau 
Get sequence
Deep sequencing
312 reads, 69.2 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64524697-64524825 [+]
Clustered miRNAs
< 10kb from oar-mir-1197
oar-mir-379chr18: 64521250-64521374 [+]
oar-mir-411achr18: 64522514-64522638 [+]
oar-mir-299chr18: 64523015-64523075 [+]
oar-mir-380chr18: 64524198-64524300 [+]
oar-mir-411bchr18: 64524359-64524459 [+]
oar-mir-1197chr18: 64524697-64524825 [+]
oar-mir-323achr18: 64524877-64524977 [+]
oar-mir-758chr18: 64525175-64525274 [+]
oar-mir-329bchr18: 64525872-64525995 [+]
oar-mir-329achr18: 64526187-64526290 [+]
oar-mir-494chr18: 64529077-64529173 [+]
oar-mir-1193chr18: 64529620-64529722 [+]
oar-mir-543chr18: 64531404-64531526 [+]
oar-mir-495chr18: 64532840-64532965 [+]
Database links

Mature sequence oar-miR-1197-5p

Accession MIMAT0019257

17 - 


 - 38

Get sequence
Deep sequencing7 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence oar-miR-1197-3p

Accession MIMAT0019258

74 - 


 - 94

Get sequence
Deep sequencing305 reads, 13 experiments
Evidence experimental; Illumina [1]


PMID:20944086 "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing" Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D Genome Res. 20:1651-1662(2010).