Stem-loop sequence oar-mir-411b

AccessionMI0016921 (change log)
DescriptionOvis aries miR-411b stem-loop
Gene family MIPF0000126; mir-379
Literature search

3 open access papers mention oar-mir-411b
(18 sentences)

Stem-loop
   cauuuc    ---u    g     a    c      aaa        gugc 
5'       gcug    augu gagag uggu gaccau   acguacgu    u
         ||||    |||| ||||| |||| ||||||   ||||||||     
3'       cgac    uacg cucuu auca cuggua   uguaugca    u
   ggaguc    ugac    a     a    c      cac        guau 
Get sequence
Deep sequencing
1895 reads, 300 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64524359-64524459 [+]
intergenic
Clustered miRNAs
< 10kb from oar-mir-411b
oar-mir-379chr18: 64521250-64521374 [+]
oar-mir-411achr18: 64522514-64522638 [+]
oar-mir-299chr18: 64523015-64523075 [+]
oar-mir-380chr18: 64524198-64524300 [+]
oar-mir-411bchr18: 64524359-64524459 [+]
oar-mir-1197chr18: 64524697-64524825 [+]
oar-mir-323achr18: 64524877-64524977 [+]
oar-mir-758chr18: 64525175-64525274 [+]
oar-mir-329bchr18: 64525872-64525995 [+]
oar-mir-329achr18: 64526187-64526290 [+]
oar-mir-494chr18: 64529077-64529173 [+]
oar-mir-1193chr18: 64529620-64529722 [+]
oar-mir-543chr18: 64531404-64531526 [+]
oar-mir-495chr18: 64532840-64532965 [+]
Database links

Mature sequence oar-miR-411b-5p

Accession MIMAT0019255
Sequence

23 - 

uggucgaccauaaaacguacgu

 - 44

Get sequence
Deep sequencing1173 reads, 13 experiments
Evidence experimental; Illumina [1]

Mature sequence oar-miR-411b-3p

Accession MIMAT0019256
Sequence

58 - 

uaugucacaugguccacuaau

 - 78

Get sequence
Deep sequencing720 reads, 13 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20944086 "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing" Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D Genome Res. 20:1651-1662(2010).