Stem-loop sequence oar-mir-379

AccessionMI0016917 (change log)
DescriptionOvis aries miR-379 stem-loop
Gene family MIPF0000126; mir-379
Literature search

5 open access papers mention oar-mir-379
(17 sentences)

Stem-loop
   cugauucuggggucagcaccacuccac  uuc   c    a    a       ga       - u ugu 
5'                            gg   cug agag uggu gacuaug  acguagg c g   g
                              ||   ||| |||| |||| |||||||  ||||||| | |    
3'                            cc   gac ucuc auca cugguac  uguaucc g c   a
   -------------aggcuccugccuaa  uau   -    a    c       aa       a u uuu 
Get sequence
Deep sequencing
6770 reads, 762 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64521250-64521374 [+]
intergenic
Clustered miRNAs
< 10kb from oar-mir-379
oar-mir-379chr18: 64521250-64521374 [+]
oar-mir-411achr18: 64522514-64522638 [+]
oar-mir-299chr18: 64523015-64523075 [+]
oar-mir-380chr18: 64524198-64524300 [+]
oar-mir-411bchr18: 64524359-64524459 [+]
oar-mir-1197chr18: 64524697-64524825 [+]
oar-mir-323achr18: 64524877-64524977 [+]
oar-mir-758chr18: 64525175-64525274 [+]
oar-mir-329bchr18: 64525872-64525995 [+]
oar-mir-329achr18: 64526187-64526290 [+]
oar-mir-494chr18: 64529077-64529173 [+]
oar-mir-1193chr18: 64529620-64529722 [+]
Database links

Mature sequence oar-miR-379-5p

Accession MIMAT0019247
Sequence

42 - 

ugguagacuauggaacguaggc

 - 63

Get sequence
Deep sequencing4189 reads, 13 experiments
Evidence experimental; Illumina [1], cloned [2]

Mature sequence oar-miR-379-3p

Accession MIMAT0019248
Sequence

80 - 

uauguaacaugguccacuaacu

 - 101

Get sequence
Deep sequencing2575 reads, 13 experiments
Evidence experimental; Illumina [1], cloned [2]

References

1
PMID:20944086 "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing" Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D Genome Res. 20:1651-1662(2010).
2
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).