![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence oar-mir-379 |
||||||||||||||||||||||||||
Accession | MI0016917 (change log) | |||||||||||||||||||||||||
Description | Ovis aries miR-379 stem-loop | |||||||||||||||||||||||||
Gene family | MIPF0000126; mir-379 | |||||||||||||||||||||||||
Literature search |
![]()
5 open access papers mention oar-mir-379 | |||||||||||||||||||||||||
Stem-loop |
cugauucuggggucagcaccacuccac uuc c a a ga - u ugu 5' gg cug agag uggu gacuaug acguagg c g g || ||| |||| |||| ||||||| ||||||| | | 3' cc gac ucuc auca cugguac uguaucc g c a -------------aggcuccugccuaa uau - a c aa a u uuu |
|||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||
Database links |
|
Mature sequence oar-miR-379-5p |
|
Accession | MIMAT0019247 |
Sequence |
42 - ugguagacuauggaacguaggc - 63 |
Deep sequencing | 4189 reads, 13 experiments |
Evidence | experimental; Illumina [1], cloned [2] |
Mature sequence oar-miR-379-3p |
|
Accession | MIMAT0019248 |
Sequence |
80 - uauguaacaugguccacuaacu - 101 |
Deep sequencing | 2575 reads, 13 experiments |
Evidence | experimental; Illumina [1], cloned [2] |
References |
|
1 |
PMID:20944086
"Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing"
Genome Res. 20:1651-1662(2010).
|
2 |
PMID:23269700
"MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200"
Physiol Genomics. 45:151-161(2013).
|