Stem-loop sequence oar-mir-3955

AccessionMI0016916 (change log)
DescriptionOvis aries miR-3955 stem-loop
Gene family MIPF0002085; mir-3955
Literature search

1 open access papers mention oar-mir-3955
(8 sentences)

Stem-loop
   augguuugaaaguaugggauacauu      -    ucc           uau 
5'                          ugaugg cuga   ucucacuacuu   a
                            |||||| ||||   |||||||||||    
3'                          acuacc gauu   agggugauggg   c
   ccacuuuuguuuagacgaacgagau      u    -uu           uuc 
Get sequence
Deep sequencing
133 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64499825-64499930 [+]
sense
ENSOART00000025644 ; SNORA79-201; exon 1
Database links

Mature sequence oar-miR-3955-5p

Accession MIMAT0019245
Sequence

24 - 

uuugauggcugauccucucacu

 - 45

Get sequence
Deep sequencing109 reads, 11 experiments
Evidence experimental; Illumina [1]

Mature sequence oar-miR-3955-3p

Accession MIMAT0019246
Sequence

64 - 

ugggauuuuaguccaucauag

 - 84

Get sequence
Deep sequencing13 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20944086 "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing" Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D Genome Res. 20:1651-1662(2010).