Stem-loop sequence oar-mir-370

AccessionMI0016915 (change log)
DescriptionOvis aries miR-370 stem-loop
Gene family MIPF0000167; mir-370
Literature search

5 open access papers mention oar-mir-370
(7 sentences)

Stem-loop
   gu   -  -  --aca       g ag      ca gu   u    uua   -  c 
5'   cug gg gc     aggcaga a  ccaggu  c  cuc gcag   cac cg u
     ||| || ||     ||||||| |  ||||||  |  ||| ||||   ||| ||  
3'   gac cc cg     ucugucu u  ggucca  g  ggg cguc   gug gc c
   -c   a  a  aucug       g cu      ag ug   u    --c   a  u 
Get sequence
Deep sequencing
165 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64412683-64412788 [+]
intergenic
Database links

Mature sequence oar-miR-370-5p

Accession MIMAT0019243
Sequence

25 - 

caggucacgucucugcaguuac

 - 46

Get sequence
Deep sequencing19 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oar-miR-370-3p

Accession MIMAT0019244
Sequence

60 - 

gccugcugggguggaaccuggucu

 - 83

Get sequence
Deep sequencing142 reads, 11 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20944086 "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing" Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D Genome Res. 20:1651-1662(2010).