Stem-loop sequence oar-mir-433

AccessionMI0016914 (change log)
DescriptionOvis aries miR-433 stem-loop
Gene family MIPF0000177; mir-433
Literature search

7 open access papers mention oar-mir-433
(11 sentences)

Stem-loop
   ----ac  a  g   gg      gua   u          uuguucagagaggcuagau 
5'       cc gu gcc  ggagaa   cgg gagccuguca                   c
         || || |||  ||||||   ||| ||||||||||                    
3'       gg cg ugg  ccucuu   gcu cucggguagu                   c
   caccac  -  a   -a      gug   c          acuaggaagaguuguuccu 
Get sequence
Deep sequencing
660 reads, 53.8 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64384195-64384308 [+]
sense
antisense
ENSOART00000015109 ; oar-mir-136-201; exon 1
Clustered miRNAs
< 10kb from oar-mir-433
oar-mir-665chr18: 64379046-64379140 [+]
oar-mir-431chr18: 64383338-64383428 [+]
oar-mir-433chr18: 64384195-64384308 [+]
oar-mir-127chr18: 64385295-64385408 [+]
oar-mir-432chr18: 64386792-64386881 [+]
oar-mir-136chr18: 64386976-64387067 [+]
Database links

Mature sequence oar-miR-433-5p

Accession MIMAT0019241
Sequence

21 - 

uacggugagccugucauuguuca

 - 43

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence oar-miR-433-3p

Accession MIMAT0019242
Sequence

73 - 

aucaugaugggcuccucggugu

 - 94

Get sequence
Deep sequencing654 reads, 13 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20944086 "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing" Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D Genome Res. 20:1651-1662(2010).