Stem-loop sequence oar-mir-665

AccessionMI0016913 (change log)
DescriptionOvis aries miR-665 stem-loop
Gene family MIPF0000404; mir-665
Literature search

2 open access papers mention oar-mir-665
(3 sentences)

Stem-loop
   cu    -   -    u   -                -   cc  g  c 
5'   ggag gag gguc ccu ugaggggucuuggccu cug  ca ga u
     |||| ||| |||| ||| |||||||||||||||| |||  || || c
3'   ucuc uuc ucgg gga acuccccggagccgga gac  gu cu u
   cc    a   g    c   c                u   ca  a  u 
Get sequence
Deep sequencing
8667 reads, 969 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64379046-64379140 [+]
intergenic
Clustered miRNAs
< 10kb from oar-mir-665
oar-mir-493chr18: 64369115-64369229 [+]
oar-mir-665chr18: 64379046-64379140 [+]
oar-mir-431chr18: 64383338-64383428 [+]
oar-mir-433chr18: 64384195-64384308 [+]
oar-mir-127chr18: 64385295-64385408 [+]
oar-mir-432chr18: 64386792-64386881 [+]
oar-mir-136chr18: 64386976-64387067 [+]
Database links

Mature sequence oar-miR-665-5p

Accession MIMAT0019239
Sequence

20 - 

aggggucuuggccucugcccag

 - 41

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]

Mature sequence oar-miR-665-3p

Accession MIMAT0019240
Sequence

54 - 

accaguaggccgaggccccuca

 - 75

Get sequence
Deep sequencing8662 reads, 13 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20944086 "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing" Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D Genome Res. 20:1651-1662(2010).