Stem-loop sequence oar-mir-493

AccessionMI0016912 (change log)
DescriptionOvis aries miR-493 stem-loop
Gene family MIPF0000230; mir-493
Literature search

5 open access papers mention oar-mir-493
(5 sentences)

Stem-loop
   ----ggggcucccucuggcccc        u                    cauuc  u 
5'                       cagggccu guacaugguaggcuuucauu     gu u
                         |||||||| ||||||||||||||||||||     ||  
3'                       gucccgga cgugugucaucuggaagugg     ca g
   agguaaaugaacgacggaccgu        c                    -cuua  c 
Get sequence
Deep sequencing
4251 reads, 508 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64369115-64369229 [+]
intergenic
Clustered miRNAs
< 10kb from oar-mir-493
oar-mir-493chr18: 64369115-64369229 [+]
oar-mir-665chr18: 64379046-64379140 [+]
Database links

Mature sequence oar-miR-493-5p

Accession MIMAT0019237
Sequence

26 - 

uuguacaugguaggcuuucauu

 - 47

Get sequence
Deep sequencing3024 reads, 13 experiments
Evidence experimental; Illumina [1]

Mature sequence oar-miR-493-3p

Accession MIMAT0019238
Sequence

67 - 

ugaaggucuacugugugccagg

 - 88

Get sequence
Deep sequencing1219 reads, 13 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20944086 "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing" Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D Genome Res. 20:1651-1662(2010).