Stem-loop sequence hsa-mir-4540

Accession MI0016911
Description Homo sapiens miR-4540 stem-loop
Stem-loop 
--aag     u  ac       -u   ac 
     cugca gg  caggacu  ggc  c
     ||||| ||  |||||||  |||  u
     gaugu cc  guccuga  ccg  u
auuug     -  --       uu   gu
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr9: 36864251-36864305 [-]
sense
OTTHUMT00000379558 ; PAX5-015; intron 1
OTTHUMT00000379558 ; PAX5-015; intron 1
OTTHUMT00000379558 ; PAX5-015; intron 1
OTTHUMT00000379557 ; PAX5-014; intron 5
OTTHUMT00000379557 ; PAX5-014; intron 5
OTTHUMT00000379557 ; PAX5-014; intron 5
OTTHUMT00000379548 ; PAX5-006; intron 6
OTTHUMT00000379549 ; PAX5-007; intron 6
OTTHUMT00000379551 ; PAX5-008; intron 6
OTTHUMT00000379553 ; PAX5-010; intron 6
OTTHUMT00000379548 ; PAX5-006; intron 6
OTTHUMT00000379549 ; PAX5-007; intron 6
OTTHUMT00000379551 ; PAX5-008; intron 6
OTTHUMT00000379553 ; PAX5-010; intron 6
OTTHUMT00000379548 ; PAX5-006; intron 6
OTTHUMT00000379549 ; PAX5-007; intron 6
OTTHUMT00000379551 ; PAX5-008; intron 6
OTTHUMT00000379553 ; PAX5-010; intron 6
OTTHUMT00000379546 ; PAX5-002; intron 7
OTTHUMT00000379547 ; PAX5-003; intron 7
OTTHUMT00000379550 ; PAX5-005; intron 7
OTTHUMT00000379552 ; PAX5-009; intron 7
OTTHUMT00000379555 ; PAX5-013; intron 7
OTTHUMT00000379556 ; PAX5-012; intron 7
OTTHUMT00000379546 ; PAX5-002; intron 7
OTTHUMT00000379547 ; PAX5-003; intron 7
OTTHUMT00000379550 ; PAX5-005; intron 7
OTTHUMT00000379552 ; PAX5-009; intron 7
OTTHUMT00000379555 ; PAX5-013; intron 7
OTTHUMT00000379556 ; PAX5-012; intron 7
OTTHUMT00000379546 ; PAX5-002; intron 7
OTTHUMT00000379547 ; PAX5-003; intron 7
OTTHUMT00000379550 ; PAX5-005; intron 7
OTTHUMT00000379552 ; PAX5-009; intron 7
OTTHUMT00000379555 ; PAX5-013; intron 7
OTTHUMT00000379556 ; PAX5-012; intron 7
OTTHUMT00000052433 ; PAX5-001; intron 8
OTTHUMT00000379545 ; PAX5-004; intron 8
OTTHUMT00000379554 ; PAX5-011; intron 8
OTTHUMT00000052433 ; PAX5-001; intron 8
OTTHUMT00000379545 ; PAX5-004; intron 8
OTTHUMT00000379554 ; PAX5-011; intron 8
OTTHUMT00000052433 ; PAX5-001; intron 8
OTTHUMT00000379545 ; PAX5-004; intron 8
OTTHUMT00000379554 ; PAX5-011; intron 8
ENST00000522932 ; PAX5-015; intron 1
ENST00000522932 ; PAX5-015; intron 1
ENST00000522932 ; PAX5-015; intron 1
ENST00000524340 ; PAX5-014; intron 5
ENST00000524340 ; PAX5-014; intron 5
ENST00000524340 ; PAX5-014; intron 5
ENST00000523241 ; PAX5-006; intron 6
ENST00000520154 ; PAX5-007; intron 6
ENST00000446742 ; PAX5-008; intron 6
ENST00000523145 ; PAX5-010; intron 6
ENST00000523145 ; PAX5-010; intron 6
ENST00000446742 ; PAX5-008; intron 6
ENST00000520154 ; PAX5-007; intron 6
ENST00000523241 ; PAX5-006; intron 6
ENST00000523241 ; PAX5-006; intron 6
ENST00000520154 ; PAX5-007; intron 6
ENST00000446742 ; PAX5-008; intron 6
ENST00000523145 ; PAX5-010; intron 6
ENST00000377840 ; PAX5-002; intron 7
ENST00000377852 ; PAX5-003; intron 7
ENST00000520281 ; PAX5-005; intron 7
ENST00000522003 ; PAX5-009; intron 7
ENST00000414447 ; PAX5-013; intron 7
ENST00000377847 ; PAX5-012; intron 7
ENST00000522003 ; PAX5-009; intron 7
ENST00000414447 ; PAX5-013; intron 7
ENST00000377847 ; PAX5-012; intron 7
ENST00000520281 ; PAX5-005; intron 7
ENST00000377852 ; PAX5-003; intron 7
ENST00000377840 ; PAX5-002; intron 7
ENST00000377840 ; PAX5-002; intron 7
ENST00000377852 ; PAX5-003; intron 7
ENST00000520281 ; PAX5-005; intron 7
ENST00000522003 ; PAX5-009; intron 7
ENST00000414447 ; PAX5-013; intron 7
ENST00000377847 ; PAX5-012; intron 7
ENST00000358127 ; PAX5-001; intron 8
ENST00000377853 ; PAX5-004; intron 8
ENST00000523493 ; PAX5-011; intron 8
ENST00000523493 ; PAX5-011; intron 8
ENST00000377853 ; PAX5-004; intron 8
ENST00000358127 ; PAX5-001; intron 8
ENST00000358127 ; PAX5-001; intron 8
ENST00000377853 ; PAX5-004; intron 8
ENST00000523493 ; PAX5-011; intron 8
ENST00000377849 ; PAX5-201; intron 9
ENST00000377849 ; PAX5-201; intron 9
Database links

Mature sequence hsa-miR-4540

Accession MIMAT0019083
Sequence

35 -  

uuaguccugccuguagguuua

 - 55

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).