|
miRBase |
|
Stem-loop sequence hsa-mir-4539 |
||||||||
| Accession | MI0016910 | |||||||
| Description | Homo sapiens miR-4539 stem-loop | |||||||
| Gene family | MIPF0001456; mir-4537 | |||||||
| Stem-loop |
-- g g -----u gu g u agcu ggcuc gcu gcu ugcu | |||| ||||| ||| ||| ||| g g ucga ucggg cga cgg acga cg g g ucaagu gu g |
|||||||
| Deep sequencing |
| |||||||
| Genome context |
|
|||||||
| Clustered miRNAs |
|
|||||||
| Database links |
|
|||||||
Mature sequence hsa-miR-4539 |
|
| Accession | MIMAT0019082 |
| Sequence |
39 - gcugaacugggcugagcugggc - 60 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|