|
miRBase |
|
Stem-loop sequence hsa-mir-4537 |
||||||||
| Accession | MI0016908 | |||||||
| Description | Homo sapiens miR-4537 stem-loop | |||||||
| Gene family | MIPF0001456; mir-4537 | |||||||
| Stem-loop |
-- g cg g g g aa u agc agcu agcuuagcu ggcu agcu c | ||| |||| ||||||||| |||| |||| a ucg ucga ucgggucga ucgg ucgg c cg g ag g g g ga |
|||||||
| Deep sequencing |
| |||||||
| Genome context |
|
|||||||
| Clustered miRNAs |
|
|||||||
| Database links |
|
|||||||
Mature sequence hsa-miR-4537 |
|
| Accession | MIMAT0019080 |
| Sequence |
1 - ugagccgagcugagcuuagcug - 22 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|