Stem-loop sequence hsa-mir-548an

Accession MI0016907
Description Homo sapiens miR-548an stem-loop
Gene family MIPF0000317; mir-548
Stem-loop 
c                   c               uauaa 
 auuagguuggugcaaaagg auugugguuuuugcc     a
 ||||||||||||||||||| |||||||||||||||      
 uaauccaaccacguuuucc uaacgccaaaaacgg     a
-                   u               uaaug
Get sequence
Deep sequencing
15 reads, 9 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chrX: 105883044-105883126 [+]
sense
OTTHUMT00000057802 ; CXorf57-004; intron 1
OTTHUMT00000057802 ; CXorf57-004; intron 1
OTTHUMT00000057802 ; CXorf57-004; intron 1
OTTHUMT00000057801 ; CXorf57-003; intron 8
OTTHUMT00000057801 ; CXorf57-003; intron 8
OTTHUMT00000057801 ; CXorf57-003; intron 8
OTTHUMT00000057800 ; CXorf57-002; intron 9
OTTHUMT00000057800 ; CXorf57-002; intron 9
OTTHUMT00000057800 ; CXorf57-002; intron 9
ENST00000478395 ; CXorf57-004; intron 1
ENST00000408286 ; AL590808.1-201; exon 1
ENST00000478395 ; CXorf57-004; intron 1
ENST00000408286 ; MIR548AN-201; exon 1
ENST00000478395 ; CXorf57-004; intron 1
ENST00000372544 ; CXorf57-201; intron 8
ENST00000421550 ; CXorf57-003; intron 8
ENST00000421550 ; CXorf57-003; intron 8
ENST00000372544 ; CXorf57-201; intron 8
ENST00000421550 ; CXorf57-003; intron 8
ENST00000372544 ; CXorf57-201; intron 8
ENST00000372548 ; CXorf57-002; intron 9
ENST00000372548 ; CXorf57-002; intron 9
ENST00000372548 ; CXorf57-002; intron 9
Database links

Mature sequence hsa-miR-548an

Accession MIMAT0019079
Sequence

15 -  

aaaaggcauugugguuuuug

 - 34

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).