Stem-loop sequence hsa-mir-548am

Accession

MI0016904

Description

Homo sapiens miR-548am stem-loop

Gene family

MIPF0000317; mir-548

Stem-loop

a                                cga 
 guuggugcaaaaguaauugcgguuuuugccgu   a
 ||||||||||||||||||||||||||||||||    
 uaaccauguuuucauugacgucaaaaacggua   a
g                                aua 

Deep sequencing

151 reads, 18 experiments

Genome context

• Coordinates (GRCh37.p5): chrX: 16645135-16645208 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000055906 ; CTPS2-001; intron 14

  OTTHUMT00000055907 ; CTPS2-002; intron 14

  OTTHUMT00000055906 ; CTPS2-001; intron 14

  OTTHUMT00000055907 ; CTPS2-002; intron 14

  OTTHUMT00000055906 ; CTPS2-001; intron 14

  OTTHUMT00000055907 ; CTPS2-002; intron 14

  ENST00000380241 ; CTPS2-001; intron 14

  ENST00000359276 ; CTPS2-002; intron 14

  ENST00000443824 ; CTPS2-202; intron 14

  ENST00000380241 ; CTPS2-001; intron 14

  ENST00000359276 ; CTPS2-002; intron 14

  ENST00000443824 ; CTPS2-202; intron 14

  ENST00000380241 ; CTPS2-001; intron 14

  ENST00000359276 ; CTPS2-002; intron 14

  ENST00000443824 ; CTPS2-201; intron 14

  antisense

  ENST00000410358 ; AL445467.1-201; exon 1

  ENST00000410358 ; MIR548AM-201; exon 1

Database links

• ENTREZGENE: 100616428;MIR548AM

Mature sequence hsa-miR-548am-5p

• Accession: MIMAT0022740
• Sequence: 10 - aaaaguaauugcgguuuuugcc - 31
• Deep sequencing: 80 reads, 14 experiments
• Evidence: not experimental
• Predicted targets:
  • DIANA-MICROT:hsa-miR-548am-5p
  • MIRDB:hsa-miR-548am-5p
  • TARGETMINER:hsa-miR-548am-5p

Mature sequence hsa-miR-548am-3p

• Accession: MIMAT0019076
• Previous IDs: hsa-miR-548am
• Sequence: 46 - caaaaacugcaguuacuuuugu - 67
• Deep sequencing: 71 reads, 13 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-548am-3p
  • MIRDB:hsa-miR-548am-3p
  • TARGETMINER:hsa-miR-548am-3p

References

1. PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).