Stem-loop sequence hsa-mir-378i

AccessionMI0016902 (change log)
Symbol HGNC:MIR378I
DescriptionHomo sapiens miR-378i stem-loop
Literature search

189 open access papers mention hsa-mir-378i
(897 sentences)

Stem-loop
   g      c  ga     a   a  ag    -  uu ugg 
5'  ggagca ug  cuagg guc ga  gugg ag  c   g
    |||||| ||  ||||| ||| ||  |||| ||  |    
3'  ucuugu ac  ggucc cgg uu  cacc uu  g   u
   g      -  -g     -   g  cu    c  uu ucg 
Get sequence
Deep sequencing
5694630 reads, 5.08e+03 reads per million, 151 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 41923222-41923297 [-]
sense
OTTHUMT00000320701 ; POLR3H-001; 3'UTR (exon 6)
ENST00000355209 ; POLR3H-001; 3'UTR (exon 6)
ENST00000396504 ; POLR3H-201; 3'UTR (exon 7)
antisense
OTTHUMT00000259151 ; ACO2-001; 3'UTR (exon 16)
OTTHUMT00000259152 ; ACO2-002; 3'UTR (exon 16)
ENST00000216254 ; ACO2-001; 3'UTR (exon 16)
ENST00000396512 ; ACO2-002; 3'UTR (exon 16)
Database links

Mature sequence hsa-miR-378i

Accession MIMAT0019074
Sequence

7 - 

acuggacuaggagucagaagg

 - 27

Get sequence
Deep sequencing5694609 reads, 151 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).