Stem-loop sequence hsa-mir-4529

Accession MI0016896
Description Homo sapiens miR-4529 stem-loop
Gene family MIPF0001451; mir-4529
Stem-loop
-----a    a                          gaa 
      ugac ggccaucagcaguccaaugaagacau   g
      |||| ||||||||||||||||||||||||||   a
      acug ccgguagucgucagguuacuucugua   c
aggguc    c                          acc 
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr18: 53146452-53146529 [+]
antisense
OTTHUMT00000421631 ; TCF4-009; intron 1
OTTHUMT00000421656 ; TCF4-028; intron 1
OTTHUMT00000421663 ; TCF4-030; intron 1
OTTHUMT00000421631 ; TCF4-009; intron 1
OTTHUMT00000421656 ; TCF4-028; intron 1
OTTHUMT00000421663 ; TCF4-030; intron 1
OTTHUMT00000421629 ; TCF4-008; intron 2
OTTHUMT00000421632 ; TCF4-007; intron 2
OTTHUMT00000421633 ; TCF4-003; intron 2
OTTHUMT00000421635 ; TCF4-005; intron 2
OTTHUMT00000421678 ; TCF4-046; intron 2
OTTHUMT00000421642 ; TCF4-041; intron 2
OTTHUMT00000421649 ; TCF4-027; intron 2
OTTHUMT00000421650 ; TCF4-021; intron 2
OTTHUMT00000421657 ; TCF4-026; intron 2
OTTHUMT00000421659 ; TCF4-025; intron 2
OTTHUMT00000421660 ; TCF4-023; intron 2
OTTHUMT00000421629 ; TCF4-008; intron 2
OTTHUMT00000421632 ; TCF4-007; intron 2
OTTHUMT00000421633 ; TCF4-003; intron 2
OTTHUMT00000421635 ; TCF4-005; intron 2
OTTHUMT00000421678 ; TCF4-046; intron 2
OTTHUMT00000421642 ; TCF4-041; intron 2
OTTHUMT00000421649 ; TCF4-027; intron 2
OTTHUMT00000421650 ; TCF4-021; intron 2
OTTHUMT00000421657 ; TCF4-026; intron 2
OTTHUMT00000421659 ; TCF4-025; intron 2
OTTHUMT00000421660 ; TCF4-023; intron 2
OTTHUMT00000256014 ; TCF4-002; intron 3
OTTHUMT00000256014 ; TCF4-002; intron 3
OTTHUMT00000421628 ; TCF4-004; intron 3
OTTHUMT00000421634 ; TCF4-006; intron 3
OTTHUMT00000421677 ; TCF4-045; intron 3
OTTHUMT00000421644 ; TCF4-019; intron 3
OTTHUMT00000421661 ; TCF4-040; intron 3
OTTHUMT00000421662 ; TCF4-029; intron 3
OTTHUMT00000421664 ; TCF4-022; intron 3
OTTHUMT00000256014 ; TCF4-002; intron 3
OTTHUMT00000421628 ; TCF4-004; intron 3
OTTHUMT00000421634 ; TCF4-006; intron 3
OTTHUMT00000421677 ; TCF4-045; intron 3
OTTHUMT00000421644 ; TCF4-019; intron 3
OTTHUMT00000421661 ; TCF4-040; intron 3
OTTHUMT00000421662 ; TCF4-029; intron 3
OTTHUMT00000421664 ; TCF4-022; intron 3
OTTHUMT00000256013 ; TCF4-001; intron 4
OTTHUMT00000256013 ; TCF4-001; intron 4
OTTHUMT00000256013 ; TCF4-001; intron 4
ENST00000543082 ; TCF4-206; intron 1
ENST00000543082 ; TCF4-009; intron 1
ENST00000563824 ; TCF4-028; intron 1
ENST00000565580 ; TCF4-030; intron 1
ENST00000543082 ; TCF4-009; intron 1
ENST00000563824 ; TCF4-028; intron 1
ENST00000565580 ; TCF4-030; intron 1
ENST00000540999 ; TCF4-205; intron 2
ENST00000537578 ; TCF4-203; intron 2
ENST00000568673 ; TCF4-008; intron 2
ENST00000540999 ; TCF4-007; intron 2
ENST00000537578 ; TCF4-003; intron 2
ENST00000568740 ; TCF4-005; intron 2
ENST00000567880 ; TCF4-046; intron 2
ENST00000566286 ; TCF4-041; intron 2
ENST00000566514 ; TCF4-027; intron 2
ENST00000568169 ; TCF4-021; intron 2
ENST00000568147 ; TCF4-026; intron 2
ENST00000563888 ; TCF4-025; intron 2
ENST00000564343 ; TCF4-023; intron 2
ENST00000568673 ; TCF4-008; intron 2
ENST00000540999 ; TCF4-007; intron 2
ENST00000537578 ; TCF4-003; intron 2
ENST00000568740 ; TCF4-005; intron 2
ENST00000567880 ; TCF4-046; intron 2
ENST00000566286 ; TCF4-041; intron 2
ENST00000566514 ; TCF4-027; intron 2
ENST00000568169 ; TCF4-021; intron 2
ENST00000568147 ; TCF4-026; intron 2
ENST00000563888 ; TCF4-025; intron 2
ENST00000564343 ; TCF4-023; intron 2
ENST00000356073 ; TCF4-002; intron 3
ENST00000354452 ; TCF4-201; intron 3
ENST00000356073 ; TCF4-002; intron 3
ENST00000565018 ; TCF4-004; intron 3
ENST00000564999 ; TCF4-006; intron 3
ENST00000566279 ; TCF4-045; intron 3
ENST00000564403 ; TCF4-019; intron 3
ENST00000562543 ; TCF4-040; intron 3
ENST00000562847 ; TCF4-029; intron 3
ENST00000569357 ; TCF4-022; intron 3
ENST00000354452 ; TCF4-201; intron 3
ENST00000356073 ; TCF4-002; intron 3
ENST00000565018 ; TCF4-004; intron 3
ENST00000564999 ; TCF4-006; intron 3
ENST00000566279 ; TCF4-045; intron 3
ENST00000564403 ; TCF4-019; intron 3
ENST00000562543 ; TCF4-040; intron 3
ENST00000562847 ; TCF4-029; intron 3
ENST00000569357 ; TCF4-022; intron 3
ENST00000354452 ; TCF4-201; intron 3
ENST00000398339 ; TCF4-001; intron 4
ENST00000398339 ; TCF4-001; intron 4
ENST00000398339 ; TCF4-001; intron 4
Database links

Mature sequence hsa-miR-4529-5p

Accession MIMAT0019236
Sequence

6 - 

aggccaucagcaguccaaugaa

 - 27

Get sequence
Evidence experimental; Solexa [2]
Predicted targets

Mature sequence hsa-miR-4529-3p

Accession MIMAT0019068
Sequence

50 - 

auuggacugcugauggcccgu

 - 70

Get sequence
Evidence experimental; Solexa [1-2]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).