|
miRBase |
|
Stem-loop sequence hsa-mir-4523 |
|||||
| Accession | MI0016890 | ||||
| Description | Homo sapiens miR-4523 stem-loop | ||||
| Stem-loop |
g - a --a g gag cggggga ccg g gggccucggcugu u g ||||||| ||| | ||||||||||||| | a gcccccu ggc c cccggagccggcg a c a u - ggg g gau |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4523 |
|
| Accession | MIMAT0019061 |
| Sequence |
7 - gaccgagagggccucggcugu - 27 |
| Deep sequencing | 9 reads, 6 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|