|
miRBase |
|
Stem-loop sequence hsa-mir-4522 |
|||||
| Accession | MI0016889 | ||||
| Description | Homo sapiens miR-4522 stem-loop | ||||
| Stem-loop |
--- c ug uggg c g -------au c g gggcgu cc ggccu gcagg ggag ccagc c | |||||| || ||||| ||||| |||| ||||| c ucugcg gg ccgga ugucc ucuc ggucg a ggu u gu ---- - g agucgccuu g |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4522 |
|
| Accession | MIMAT0019060 |
| Sequence |
55 - ugacucugccuguaggccggu - 75 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|