|
miRBase |
|
Stem-loop sequence hsa-mir-4520a |
||||||
| Accession | MI0016886 | |||||
| Description | Homo sapiens miR-4520a stem-loop | |||||
| Gene family | MIPF0001272; mir-4520 | |||||
| Stem-loop |
-gugugcca ag
ccugcguguuuucuguccaaauc a
||||||||||||||||||||||| a
ggacgcacaaaagacagguuuag a
aaggaagaa ga
|
|||||
| Deep sequencing |
| |||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
| Database links |
|
|||||
Mature sequence hsa-miR-4520a-5p |
|
| Accession | MIMAT0019235 |
| Sequence |
9 - ccugcguguuuucuguccaa - 28 |
| Evidence | experimental; Solexa [2-3] |
| Predicted targets |
|
Mature sequence hsa-miR-4520a-3p |
|
| Accession | MIMAT0019057 |
| Sequence |
42 - uuggacagaaaacacgcaggaa - 63 |
| Deep sequencing | 2 reads, 1 experiments |
| Evidence | experimental; Solexa [1-3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|
| 2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|
| 3 |
PMID:21807764
"Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome"
Hum Mol Genet. 20:4025-4040(2011).
|