Stem-loop sequence hsa-mir-4518

Accession MI0016884
Description Homo sapiens miR-4518 stem-loop
Stem-loop 
u     ---aaa  ug u gg   g   ag   u   ug    g 
 ggggg      ag  c g  auu auu  uga guc  cugg g
 |||||      ||  | |  ||| |||  ||| |||  ||||  
 ccccc      uc  g c  uag uag  acu cgg  ggcc a
u     gaagag  gu u aa   -   gg   -   --    a
Get sequence
Deep sequencing
46 reads, 14 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr16: 30515240-30515322 [+]
sense
OTTHUMT00000434523 ; ITGAL-018; intron 2
OTTHUMT00000434524 ; ITGAL-020; intron 2
OTTHUMT00000434523 ; ITGAL-018; intron 2
OTTHUMT00000434524 ; ITGAL-020; intron 2
OTTHUMT00000434512 ; ITGAL-009; intron 3
OTTHUMT00000434512 ; ITGAL-009; intron 3
OTTHUMT00000434517 ; ITGAL-004; intron 4
OTTHUMT00000434517 ; ITGAL-004; intron 4
OTTHUMT00000434511 ; ITGAL-002; intron 15
OTTHUMT00000434511 ; ITGAL-002; intron 15
OTTHUMT00000434508 ; ITGAL-001; intron 17
OTTHUMT00000434508 ; ITGAL-001; intron 17
ENST00000568987 ; ITGAL-018; intron 2
ENST00000563615 ; ITGAL-020; intron 2
ENST00000568987 ; ITGAL-018; intron 2
ENST00000563615 ; ITGAL-020; intron 2
ENST00000568926 ; ITGAL-009; intron 3
ENST00000568926 ; ITGAL-009; intron 3
ENST00000433423 ; ITGAL-203; intron 4
ENST00000433423 ; ITGAL-004; intron 4
ENST00000433423 ; ITGAL-004; intron 4
ENST00000358164 ; ITGAL-202; intron 15
ENST00000358164 ; ITGAL-002; intron 15
ENST00000358164 ; ITGAL-002; intron 15
ENST00000356798 ; ITGAL-201; intron 17
ENST00000356798 ; ITGAL-001; intron 17
ENST00000356798 ; ITGAL-001; intron 17
Database links

Mature sequence hsa-miR-4518

Accession MIMAT0019055
Sequence

50 -  

gcucagggaugauaacugugcugaga

 - 75

Get sequence
Deep sequencing 6 reads, 3 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).