Stem-loop sequence hsa-mir-4517

Accession MI0016883
Description Homo sapiens miR-4517 stem-loop
Stem-loop 
a   aa    g  ga  cu    -   ga  ag      a 
 ggu  auau au  aa  caca gcu  gg  cuuagc a
 |||  |||| ||  ||  |||| |||  ||  |||||| g
 ucg  ugug ug  uu  gugu cga  cc  gaaucg u
g   -g    g  gg  -u    u   ga  -g      a
Get sequence
Deep sequencing
27 reads, 5 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr16: 28969904-28969982 [+]
sense
OTTHUMT00000433211 ; NFATC2IP-004; 3'UTR (exon 1)
OTTHUMT00000433211 ; NFATC2IP-004; 3'UTR (exon 1)
OTTHUMT00000433206 ; NFATC2IP-003; intron 2
OTTHUMT00000433209 ; NFATC2IP-006; intron 2
OTTHUMT00000433206 ; NFATC2IP-003; intron 2
OTTHUMT00000433209 ; NFATC2IP-006; intron 2
OTTHUMT00000214999 ; NFATC2IP-001; intron 5
OTTHUMT00000214999 ; NFATC2IP-001; intron 5
OTTHUMT00000214999 ; NFATC2IP-001; intron 5
ENST00000568148 ; NFATC2IP-004; 3'UTR (exon 1)
ENST00000568148 ; NFATC2IP-004; 3'UTR (exon 1)
ENST00000564978 ; NFATC2IP-003; intron 2
ENST00000562977 ; NFATC2IP-006; intron 2
ENST00000564978 ; NFATC2IP-003; intron 2
ENST00000562977 ; NFATC2IP-006; intron 2
ENST00000320805 ; NFATC2IP-001; intron 5
ENST00000320805 ; NFATC2IP-001; intron 5
ENST00000320805 ; NFATC2IP-001; intron 5
antisense
OTTHUMT00000432714 ; RP11-264B17.2-001; intron 1
OTTHUMT00000432714 ; RP11-264B17.2-001; intron 1
ENST00000569974 ; RP11-264B17.2-001; intron 1
ENST00000569974 ; RP11-264B17.2-001; intron 1
Database links

Mature sequence hsa-miR-4517

Accession MIMAT0019054
Sequence

5 -  

aaauaugaugaaacucacagcugag

 - 29

Get sequence
Deep sequencing 27 reads, 5 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).