Stem-loop sequence hsa-mir-4513

Accession MI0016879
Description Homo sapiens miR-4513 stem-loop
Stem-loop 
a    -             -  cgg    a    cau   c gu 
 uucu agguggggagacu ga   cugg ggcc   aag u  c
 |||| ||||||||||||| ||   |||| ||||   ||| |   
 aaga uucaccccucugg cu   gacc ccgg   uuc a  u
c    c             u  uua    c    --c   a aa
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr15: 75081013-75081098 [-]
antisense
OTTHUMT00000286398 ; CSK-001; intron 1
OTTHUMT00000286398 ; CSK-001; intron 1
OTTHUMT00000421493 ; CSK-005; intron 1
OTTHUMT00000421506 ; CSK-015; intron 1
OTTHUMT00000421507 ; CSK-016; intron 1
OTTHUMT00000421495 ; CSK-006; intron 1
OTTHUMT00000286398 ; CSK-001; intron 1
OTTHUMT00000421493 ; CSK-005; intron 1
OTTHUMT00000421506 ; CSK-015; intron 1
OTTHUMT00000421507 ; CSK-016; intron 1
OTTHUMT00000421495 ; CSK-006; intron 1
OTTHUMT00000421491 ; CSK-002; intron 2
OTTHUMT00000421491 ; CSK-002; intron 2
ENST00000220003 ; CSK-001; intron 1
ENST00000451345 ; CSK-203; intron 1
ENST00000220003 ; CSK-001; intron 1
ENST00000563894 ; CSK-005; intron 1
ENST00000567123 ; CSK-015; intron 1
ENST00000569462 ; CSK-016; intron 1
ENST00000567571 ; CSK-006; intron 1
ENST00000451345 ; CSK-202; intron 1
ENST00000220003 ; CSK-001; intron 1
ENST00000563894 ; CSK-005; intron 1
ENST00000567123 ; CSK-015; intron 1
ENST00000569462 ; CSK-016; intron 1
ENST00000567571 ; CSK-006; intron 1
ENST00000439220 ; CSK-202; intron 2
ENST00000439220 ; CSK-002; intron 2
ENST00000439220 ; CSK-002; intron 2
Database links

Mature sequence hsa-miR-4513

Accession MIMAT0019050
Sequence

14 -  

agacugacggcuggaggcccau

 - 35

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).