Stem-loop sequence hsa-mir-4512

Accession

MI0016878

Description

Homo sapiens miR-4512 stem-loop

Stem-loop

c      c    a          a  uc     uaca 
 ucagcc gggc auauagugag cc  gucuc    a
 |||||| |||| |||||||||| ||  |||||    a
 ggucgg cccg uaugucacuc gg  cagag    a
a      a    c          c  ga     uuaa 

Deep sequencing

23 reads, 7 experiments

Genome context

• Coordinates (GRCh37.p5): chr15: 66789296-66789372 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000256905 ; SNAPC5-001; intron 1

  OTTHUMT00000420725 ; SNAPC5-008; intron 1

  OTTHUMT00000420726 ; SNAPC5-007; intron 1

  OTTHUMT00000420727 ; SNAPC5-006; intron 1

  OTTHUMT00000420728 ; SNAPC5-002; intron 1

  OTTHUMT00000256905 ; SNAPC5-001; intron 1

  OTTHUMT00000420729 ; SNAPC5-005; intron 1

  OTTHUMT00000420730 ; SNAPC5-003; intron 1

  OTTHUMT00000420731 ; SNAPC5-009; intron 1

  OTTHUMT00000420725 ; SNAPC5-008; intron 1

  OTTHUMT00000420726 ; SNAPC5-007; intron 1

  OTTHUMT00000420727 ; SNAPC5-006; intron 1

  OTTHUMT00000420728 ; SNAPC5-002; intron 1

  OTTHUMT00000256905 ; SNAPC5-001; intron 1

  OTTHUMT00000420729 ; SNAPC5-005; intron 1

  OTTHUMT00000420730 ; SNAPC5-003; intron 1

  OTTHUMT00000420731 ; SNAPC5-009; intron 1

  ENST00000316634 ; SNAPC5-001; intron 1

  ENST00000395589 ; SNAPC5-202; intron 1

  ENST00000307979 ; SNAPC5-201; intron 1

  ENST00000395589 ; SNAPC5-008; intron 1

  ENST00000562411 ; SNAPC5-007; intron 1

  ENST00000563480 ; SNAPC5-006; intron 1

  ENST00000568875 ; SNAPC5-002; intron 1

  ENST00000316634 ; SNAPC5-001; intron 1

  ENST00000565465 ; SNAPC5-005; intron 1

  ENST00000307979 ; SNAPC5-003; intron 1

  ENST00000566658 ; SNAPC5-009; intron 1

  ENST00000395589 ; SNAPC5-008; intron 1

  ENST00000562411 ; SNAPC5-007; intron 1

  ENST00000563480 ; SNAPC5-006; intron 1

  ENST00000568875 ; SNAPC5-002; intron 1

  ENST00000316634 ; SNAPC5-001; intron 1

  ENST00000565465 ; SNAPC5-005; intron 1

  ENST00000307979 ; SNAPC5-003; intron 1

  ENST00000566658 ; SNAPC5-009; intron 1

Database links

• ENTREZGENE: 100616149;MIR4512

Mature sequence hsa-miR-4512

• Accession: MIMAT0019049
• Sequence: 49 - cagggccucacuguaucgccca - 70
• Deep sequencing: 21 reads, 5 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4512
  • MIRDB:hsa-miR-4512
  • TARGETMINER:hsa-miR-4512

References

1. PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).