Stem-loop sequence hsa-mir-4511

Accession MI0016877
Description Homo sapiens miR-4511 stem-loop
Stem-loop 
a                                    ca uc 
 aaaaaaagggaaagaagaacuguugcauuugcccug  c  a
 ||||||||||||||||||||||||||||||||||||  |  g
 uuuuuuucccuuucuucuugauaacguaaaugggac  g  u
a                                    ac uu
Get sequence
Deep sequencing
13 reads, 7 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr15: 66011584-66011670 [-]
sense
OTTHUMT00000419609 ; DENND4A-001; intron 12
OTTHUMT00000419611 ; DENND4A-003; intron 12
OTTHUMT00000419614 ; DENND4A-005; intron 12
OTTHUMT00000419616 ; DENND4A-004; intron 12
OTTHUMT00000419609 ; DENND4A-001; intron 12
OTTHUMT00000419611 ; DENND4A-003; intron 12
OTTHUMT00000419614 ; DENND4A-005; intron 12
OTTHUMT00000419616 ; DENND4A-004; intron 12
ENST00000443035 ; DENND4A-202; intron 12
ENST00000431932 ; DENND4A-201; intron 12
ENST00000443035 ; DENND4A-001; intron 12
ENST00000431932 ; DENND4A-003; intron 12
ENST00000564674 ; DENND4A-005; intron 12
ENST00000568515 ; DENND4A-004; intron 12
ENST00000443035 ; DENND4A-001; intron 12
ENST00000431932 ; DENND4A-003; intron 12
ENST00000564674 ; DENND4A-005; intron 12
ENST00000568515 ; DENND4A-004; intron 12
Database links

Mature sequence hsa-miR-4511

Accession MIMAT0019048
Sequence

15 -  

gaagaacuguugcauuugcccu

 - 36

Get sequence
Evidence experimental; Solexa [1-2], qPCR [2]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2
PMID:21785231 "Detection of novel human MiRNAs responding to X-ray irradiation" Ding N, Wu X, He J, Chang L, Hu W, Li W, Wang J, Wang T, Zhou G J Radiat Res. 52:425-432(2011).