|
miRBase |
|
Stem-loop sequence hsa-mir-2392 |
|||||
| Accession | MI0016870 | ||||
| Description | Homo sapiens miR-2392 stem-loop | ||||
| Gene family | MIPF0001614; mir-2392 | ||||
| Stem-loop |
a uc cca ag cu a --a c ugg ccuc aucc ccauuc cag cc gguggcu c ||| |||| |||| |||||| ||| || ||||||| auc ggag uggg gguagg guc gg ccaccga c g gu -ag -- au - acc g |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-2392 |
|
| Accession | MIMAT0019043 |
| Sequence |
61 - uaggaugggggugagaggug - 80 |
| Deep sequencing | 8 reads, 3 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|