Stem-loop sequence hsa-mir-4506

Accession MI0016869
Description Homo sapiens miR-4506 stem-loop
Stem-loop 
u    u  -   a            gg    ---  uu  g 
 ggcc cu gcc ucagaccaucug  uuca   ag  ug c
 |||| || ||| ||||||||||||  ||||   ||  ||  
 cugg ga cgg agucuggugggu  aagu   uc  ac u
u    u  a   -            -a    auu  -u  c
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr14: 94414572-94414648 [-]
sense
OTTHUMT00000412848 ; ASB2-006; intron 2
OTTHUMT00000412848 ; ASB2-006; intron 2
OTTHUMT00000412848 ; ASB2-006; intron 2
OTTHUMT00000412845 ; ASB2-001; intron 4
OTTHUMT00000412847 ; ASB2-003; intron 4
OTTHUMT00000412845 ; ASB2-001; intron 4
OTTHUMT00000412847 ; ASB2-003; intron 4
OTTHUMT00000412845 ; ASB2-001; intron 4
OTTHUMT00000412847 ; ASB2-003; intron 4
OTTHUMT00000412844 ; ASB2-002; intron 6
OTTHUMT00000412844 ; ASB2-002; intron 6
OTTHUMT00000412844 ; ASB2-002; intron 6
ENST00000556337 ; ASB2-006; intron 2
ENST00000556337 ; ASB2-006; intron 2
ENST00000556337 ; ASB2-006; intron 2
ENST00000315988 ; ASB2-001; intron 4
ENST00000555507 ; ASB2-003; intron 4
ENST00000543546 ; ASB2-202; intron 4
ENST00000315988 ; ASB2-001; intron 4
ENST00000555507 ; ASB2-003; intron 4
ENST00000543546 ; ASB2-202; intron 4
ENST00000315988 ; ASB2-001; intron 4
ENST00000555507 ; ASB2-003; intron 4
ENST00000555019 ; ASB2-002; intron 6
ENST00000555019 ; ASB2-002; intron 6
ENST00000555019 ; ASB2-002; intron 6
ENST00000434324 ; ASB2-201; intron 7
ENST00000434324 ; ASB2-201; intron 7
Database links

Mature sequence hsa-miR-4506

Accession MIMAT0019042
Sequence

51 -  

aaauggguggucugaggcaa

 - 70

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).