Stem-loop sequence hsa-mir-4504

Accession MI0016867
Description Homo sapiens miR-4504 stem-loop
Gene family MIPF0001508; mir-4504
Stem-loop 
c                 g                  uu    ca 
 uaagauaauguccucca guucaucucuguugucau  gugg  u
 ||||||||||||||||| ||||||||||||||||||  ||||   
 auucuauuauaggaggu caaguagagauaacagug  uacc  g
a                 a                  uu    ag
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr14: 50766573-50766664 [-]
sense
OTTHUMT00000276871 ; L2HGDH-002; intron 3
OTTHUMT00000276870 ; L2HGDH-001; intron 3
OTTHUMT00000410749 ; L2HGDH-003; intron 3
OTTHUMT00000410750 ; L2HGDH-008; intron 3
OTTHUMT00000410751 ; L2HGDH-004; intron 3
OTTHUMT00000410752 ; L2HGDH-007; intron 3
OTTHUMT00000276871 ; L2HGDH-002; intron 3
OTTHUMT00000276870 ; L2HGDH-001; intron 3
OTTHUMT00000410749 ; L2HGDH-003; intron 3
OTTHUMT00000410750 ; L2HGDH-008; intron 3
OTTHUMT00000410751 ; L2HGDH-004; intron 3
OTTHUMT00000410752 ; L2HGDH-007; intron 3
OTTHUMT00000276871 ; L2HGDH-002; intron 3
OTTHUMT00000276870 ; L2HGDH-001; intron 3
OTTHUMT00000410749 ; L2HGDH-003; intron 3
OTTHUMT00000410750 ; L2HGDH-008; intron 3
OTTHUMT00000410751 ; L2HGDH-004; intron 3
OTTHUMT00000410752 ; L2HGDH-007; intron 3
OTTHUMT00000410753 ; L2HGDH-005; intron 4
OTTHUMT00000410753 ; L2HGDH-005; intron 4
OTTHUMT00000410753 ; L2HGDH-005; intron 4
ENST00000261699 ; L2HGDH-002; intron 3
ENST00000267436 ; L2HGDH-001; intron 3
ENST00000421284 ; L2HGDH-003; intron 3
ENST00000557131 ; L2HGDH-008; intron 3
ENST00000555423 ; L2HGDH-004; intron 3
ENST00000555610 ; L2HGDH-007; intron 3
ENST00000261699 ; L2HGDH-002; intron 3
ENST00000267436 ; L2HGDH-001; intron 3
ENST00000421284 ; L2HGDH-003; intron 3
ENST00000557131 ; L2HGDH-008; intron 3
ENST00000555423 ; L2HGDH-004; intron 3
ENST00000555610 ; L2HGDH-007; intron 3
ENST00000261699 ; L2HGDH-002; intron 3
ENST00000267436 ; L2HGDH-001; intron 3
ENST00000421284 ; L2HGDH-003; intron 3
ENST00000557131 ; L2HGDH-008; intron 3
ENST00000555423 ; L2HGDH-004; intron 3
ENST00000555610 ; L2HGDH-007; intron 3
ENST00000554191 ; L2HGDH-005; intron 4
ENST00000554191 ; L2HGDH-005; intron 4
ENST00000554191 ; L2HGDH-005; intron 4
Database links

Mature sequence hsa-miR-4504

Accession MIMAT0019040
Sequence

55 -  

ugugacaauagagaugaacaug

 - 76

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).