|
miRBase |
|
Stem-loop sequence hsa-mir-4501 |
|||||
| Accession | MI0016864 | ||||
| Description | Homo sapiens miR-4501 stem-loop | ||||
| Stem-loop |
--u c g uc u auaug augugac uc gaugaa ac gaa u ||||||| || |||||| || ||| uacacug ag cuacuu ug cuu c uuu u a -- u cgagu |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4501 |
|
| Accession | MIMAT0019037 |
| Sequence |
1 - uaugugaccucggaugaauca - 21 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|