Stem-loop sequence hsa-mir-4498

Accession MI0016860
Description Homo sapiens miR-4498 stem-loop
Stem-loop 
a   cu gg  --       caagu     --    c 
 ggg  g  cu  ggcaggg     gcugc  agau u
 |||  |  ||  |||||||     |||||  ||||  
 ccc  c  gg  ccguccc     cgacg  ucug u
a   -u ua  uu       -----     aa    u
Get sequence
Deep sequencing
3 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr12: 120593238-120593303 [-]
sense
OTTHUMT00000403595 ; GCN1L1-006; intron 1
OTTHUMT00000403595 ; GCN1L1-006; intron 1
OTTHUMT00000403595 ; GCN1L1-006; intron 1
OTTHUMT00000403596 ; GCN1L1-005; intron 3
OTTHUMT00000403596 ; GCN1L1-005; intron 3
OTTHUMT00000403596 ; GCN1L1-005; intron 3
OTTHUMT00000403592 ; GCN1L1-001; intron 29
OTTHUMT00000403592 ; GCN1L1-001; intron 29
OTTHUMT00000403592 ; GCN1L1-001; intron 29
ENST00000548132 ; GCN1L1-006; intron 1
ENST00000548132 ; GCN1L1-006; intron 1
ENST00000548132 ; GCN1L1-006; intron 1
ENST00000551920 ; GCN1L1-005; intron 3
ENST00000551920 ; GCN1L1-005; intron 3
ENST00000551920 ; GCN1L1-005; intron 3
ENST00000300648 ; GCN1L1-001; intron 29
ENST00000300648 ; GCN1L1-001; intron 29
ENST00000300648 ; GCN1L1-001; intron 29
Database links

Mature sequence hsa-miR-4498

Accession MIMAT0019033
Sequence

6 -  

ugggcuggcagggcaagugcug

 - 27

Get sequence
Deep sequencing 3 reads, 1 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).