Stem-loop sequence hsa-mir-4490

Accession MI0016852
Description Homo sapiens miR-4490 stem-loop
Stem-loop 
a         ca              g    a      gaa 
 uaguuucug  augcucaaaucucu gcca agacca   c
 |||||||||  |||||||||||||| |||| ||||||    
 aucaaagau  uacggguuuagaga uggu ucuggu   u
a         ua              a    c      aau
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr11: 90288942-90289025 [-]
antisense
OTTHUMT00000421430 ; RP11-660M18.2-003; intron 2
OTTHUMT00000421420 ; RP11-660M18.2-001; intron 2
OTTHUMT00000421431 ; RP11-660M18.2-004; intron 2
OTTHUMT00000421432 ; RP11-660M18.2-005; intron 2
OTTHUMT00000421430 ; RP11-660M18.2-003; intron 2
OTTHUMT00000421420 ; RP11-660M18.2-001; intron 2
OTTHUMT00000421431 ; RP11-660M18.2-004; intron 2
OTTHUMT00000421432 ; RP11-660M18.2-005; intron 2
ENST00000562245 ; RP11-660M18.2-003; intron 2
ENST00000561596 ; RP11-660M18.2-001; intron 2
ENST00000562678 ; RP11-660M18.2-004; intron 2
ENST00000563681 ; RP11-660M18.2-005; intron 2
ENST00000562245 ; RP11-660M18.2-003; intron 2
ENST00000561596 ; RP11-660M18.2-001; intron 2
ENST00000562678 ; RP11-660M18.2-004; intron 2
ENST00000563681 ; RP11-660M18.2-005; intron 2
Database links

Mature sequence hsa-miR-4490

Accession MIMAT0019025
Sequence

52 -  

ucugguaagagauuugggcaua

 - 73

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).