Stem-loop sequence hsa-mir-548al

Accession MI0016851
Description Homo sapiens miR-548al stem-loop
Gene family MIPF0000317; mir-548
Stem-loop 
--------   c           a                   aaaa      
        ggu ggugcaaaagu auugcuguuuuugccauua    uaaug 
        ||| ||||||||||| |||||||||||||||||||    |||| g
        cua ccauguuuuca uaacggcaaaaacgguaau    auuac 
ucuauaau   a           g                   gaaa
Get sequence
Deep sequencing
14 reads, 9 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr11: 74110282-74110378 [+]
sense
OTTHUMT00000385554 ; RP11-702H23.4-002; intron 2
OTTHUMT00000385541 ; RP11-702H23.4-001; intron 2
OTTHUMT00000385554 ; RP11-702H23.4-002; intron 2
OTTHUMT00000385541 ; RP11-702H23.4-001; intron 2
OTTHUMT00000385554 ; RP11-702H23.4-002; intron 2
OTTHUMT00000385541 ; RP11-702H23.4-001; intron 2
ENST00000531906 ; RP11-702H23.4-002; intron 2
ENST00000533008 ; RP11-702H23.4-001; intron 2
ENST00000531906 ; RP11-702H23.4-002; intron 2
ENST00000533008 ; RP11-702H23.4-001; intron 2
ENST00000531906 ; RP11-702H23.4-002; intron 2
ENST00000533008 ; RP11-702H23.4-001; intron 2
Database links

Mature sequence hsa-miR-548al

Accession MIMAT0019024
Sequence

65 -  

aacggcaaugacuuuuguacca

 - 86

Get sequence
Deep sequencing 4 reads, 3 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).