Stem-loop sequence hsa-mir-548al

AccessionMI0016851 (change log)
Symbol HGNC:MIR548AL
DescriptionHomo sapiens miR-548al stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548al
(170 sentences)

Stem-loop
   --------   c           a                   aaaa      
5'         ggu ggugcaaaagu auugcuguuuuugccauua    uaaug 
           ||| ||||||||||| |||||||||||||||||||    |||| g
3'         cua ccauguuuuca uaacggcaaaaacgguaau    auuac 
   ucuauaau   a           g                   gaaa      
Get sequence
Deep sequencing
3542 reads, 1.47 reads per million, 136 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 74399237-74399333 [+]
intergenic
Database links

Mature sequence hsa-miR-548al

Accession MIMAT0019024
Sequence

65 - 

aacggcaaugacuuuuguacca

 - 86

Get sequence
Deep sequencing291 reads, 83 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).