Stem-loop sequence hsa-mir-4489

Accession MI0016850
Description Homo sapiens miR-4489 stem-loop
Stem-loop 
g    ug   c   ugau       ---g  - g 
 gggg  ggg uag    gcaggac    cu g g
 ||||  ||| |||    |||||||    || |  
 cccu  ccc guc    cguccug    gg c g
a    gu   a   ----       aaga  u a
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr11: 65416663-65416724 [+]
sense
OTTHUMT00000390359 ; SIPA1-008; intron 1
OTTHUMT00000390359 ; SIPA1-008; intron 1
OTTHUMT00000390359 ; SIPA1-008; intron 1
OTTHUMT00000390352 ; SIPA1-001; intron 9
OTTHUMT00000390356 ; SIPA1-003; intron 9
OTTHUMT00000390352 ; SIPA1-001; intron 9
OTTHUMT00000390356 ; SIPA1-003; intron 9
OTTHUMT00000390352 ; SIPA1-001; intron 9
OTTHUMT00000390356 ; SIPA1-003; intron 9
OTTHUMT00000390355 ; SIPA1-002; intron 10
OTTHUMT00000390355 ; SIPA1-002; intron 10
OTTHUMT00000390355 ; SIPA1-002; intron 10
ENST00000531339 ; SIPA1-008; intron 1
ENST00000531339 ; SIPA1-008; intron 1
ENST00000531339 ; SIPA1-008; intron 1
ENST00000534313 ; SIPA1-001; intron 9
ENST00000394224 ; SIPA1-003; intron 9
ENST00000394227 ; SIPA1-201; intron 9
ENST00000534313 ; SIPA1-001; intron 9
ENST00000394224 ; SIPA1-003; intron 9
ENST00000394227 ; SIPA1-201; intron 9
ENST00000534313 ; SIPA1-001; intron 9
ENST00000394224 ; SIPA1-003; intron 9
ENST00000394227 ; SIPA1-201; intron 9
ENST00000527525 ; SIPA1-002; intron 10
ENST00000527525 ; SIPA1-002; intron 10
ENST00000527525 ; SIPA1-002; intron 10
Database links

Mature sequence hsa-miR-4489

Accession MIMAT0019023
Sequence

6 -  

uggggcuagugaugcaggacg

 - 26

Get sequence
Evidence experimental; Solexa [1-2]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).