Stem-loop sequence hsa-mir-4484

Accession

MI0016845

Description

Homo sapiens miR-4484 stem-loop

Gene family

MIPF0001440; mir-4484

Stem-loop

--       cu          uu  ---    -a        a 
  ggguuuc  cugccuuuuu  cc   aaug  aaauaacg a
  |||||||  ||||||||||  ||   ||||  |||||||| a
  cccgaag  ggcggaaaaa  gg   uuac  uuuauugu c
ac       ag          gg  gag    cc        c 

Deep sequencing

311 reads, 34 experiments

Genome context

• Coordinates (GRCh37.p5): chr10: 127508309-127508391 [+]
• Overlapping transcripts:

  antisense

  OTTHUMT00000050929 ; UROS-001; intron 1

  OTTHUMT00000050932 ; UROS-004; intron 1

  OTTHUMT00000050931 ; UROS-003; intron 1

  OTTHUMT00000050934 ; UROS-006; intron 1

  OTTHUMT00000050929 ; UROS-001; intron 1

  OTTHUMT00000050932 ; UROS-004; intron 1

  OTTHUMT00000050931 ; UROS-003; intron 1

  OTTHUMT00000050934 ; UROS-006; intron 1

  OTTHUMT00000050929 ; UROS-001; intron 1

  OTTHUMT00000050932 ; UROS-004; intron 1

  OTTHUMT00000050931 ; UROS-003; intron 1

  OTTHUMT00000050934 ; UROS-006; intron 1

  ENST00000368797 ; UROS-001; intron 1

  ENST00000420761 ; UROS-004; intron 1

  ENST00000368778 ; UROS-003; intron 1

  ENST00000368774 ; UROS-006; intron 1

  ENST00000368797 ; UROS-001; intron 1

  ENST00000420761 ; UROS-004; intron 1

  ENST00000368778 ; UROS-003; intron 1

  ENST00000368774 ; UROS-006; intron 1

  ENST00000368797 ; UROS-001; intron 1

  ENST00000420761 ; UROS-004; intron 1

  ENST00000368778 ; UROS-003; intron 1

  ENST00000368774 ; UROS-006; intron 1

Database links

• ENTREZGENE: 100616327;MIR4484

Mature sequence hsa-miR-4484

• Accession: MIMAT0019018
• Sequence: 64 - aaaaggcgggagaagcccca - 83
• Deep sequencing: 303 reads, 27 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4484
  • MIRDB:hsa-miR-4484
  • TARGETMINER:hsa-miR-4484

References

1. PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).