|
miRBase |
|
Stem-loop sequence hsa-mir-4482 |
|||||
| Accession | MI0016843 | ||||
| Previous IDs | hsa-mir-4482;hsa-mir-4482-1 | ||||
| Description | Homo sapiens miR-4482 stem-loop | ||||
| Gene family | MIPF0001339; mir-4482 | ||||
| Stem-loop |
a caa g cu gugg gugag ccca uggg auggaaaugu a ||||| |||| |||| |||||||||| cauuc gggu acuc uaucuuuacg a c ucg g uu guag |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4482-5p |
|
| Accession | MIMAT0019016 |
| Previous IDs | hsa-miR-4482 |
| Sequence |
8 - aacccagugggcuauggaaaug - 29 |
| Evidence | experimental; Solexa [1,3], qPCR [3] |
| Predicted targets |
|
Mature sequence hsa-miR-4482-3p |
|
| Accession | MIMAT0020958 |
| Sequence |
44 - uuucuauuucucaguggggcuc - 65 |
| Evidence | not experimental |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|
| 2 |
PMID:21558790
"Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis"
RNA Biol. 8:378-383(2011).
|
| 3 |
PMID:21785231
"Detection of novel human MiRNAs responding to X-ray irradiation"
J Radiat Res. 52:425-432(2011).
|