|
miRBase |
|
Stem-loop sequence hsa-mir-4480 |
|||||
| Accession | MI0016841 | ||||
| Description | Homo sapiens miR-4480 stem-loop | ||||
| Stem-loop |
u c ag c ccag gcagaggugag ugac uccac ggc ac g ||||||||||| |||| ||||| ||| || g ugucuccauuu auug aggug ccg ug a c a aa a aaug |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4480 |
|
| Accession | MIMAT0019014 |
| Sequence |
44 - agccaaguggaaguuacuuua - 64 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|