Stem-loop sequence hsa-mir-548ak

Accession

MI0016840

Description

Homo sapiens miR-548ak stem-loop

Gene family

MIPF0000317; mir-548

Stem-loop

g           c         ug ga 
 ugcaaaaguaa ugcgguuuu  a  a
 ||||||||||| |||||||||  |  g
 acguuuucauu acgccaaaa  u  u
g           a         gu aa 

Deep sequencing

35 reads, 15 experiments

Genome context

• Coordinates (GRCh37.p5): chr10: 12172759-12172815 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000046797 ; SEC61A2-011; intron 1

  OTTHUMT00000046788 ; SEC61A2-002; intron 1

  OTTHUMT00000046792 ; SEC61A2-006; intron 1

  OTTHUMT00000046795 ; SEC61A2-009; intron 1

  OTTHUMT00000046793 ; SEC61A2-007; intron 1

  OTTHUMT00000046794 ; SEC61A2-008; intron 1

  OTTHUMT00000046798 ; SEC61A2-012; intron 1

  OTTHUMT00000046796 ; SEC61A2-010; intron 1

  OTTHUMT00000046787 ; SEC61A2-001; intron 1

  OTTHUMT00000046797 ; SEC61A2-011; intron 1

  OTTHUMT00000046788 ; SEC61A2-002; intron 1

  OTTHUMT00000046792 ; SEC61A2-006; intron 1

  OTTHUMT00000046795 ; SEC61A2-009; intron 1

  OTTHUMT00000046793 ; SEC61A2-007; intron 1

  OTTHUMT00000046794 ; SEC61A2-008; intron 1

  OTTHUMT00000046798 ; SEC61A2-012; intron 1

  OTTHUMT00000046796 ; SEC61A2-010; intron 1

  OTTHUMT00000046787 ; SEC61A2-001; intron 1

  OTTHUMT00000046797 ; SEC61A2-011; intron 1

  OTTHUMT00000046788 ; SEC61A2-002; intron 1

  OTTHUMT00000046792 ; SEC61A2-006; intron 1

  OTTHUMT00000046795 ; SEC61A2-009; intron 1

  OTTHUMT00000046793 ; SEC61A2-007; intron 1

  OTTHUMT00000046794 ; SEC61A2-008; intron 1

  OTTHUMT00000046798 ; SEC61A2-012; intron 1

  OTTHUMT00000046796 ; SEC61A2-010; intron 1

  OTTHUMT00000046787 ; SEC61A2-001; intron 1

  ENST00000379051 ; SEC61A2-011; intron 1

  ENST00000441368 ; SEC61A2-002; intron 1

  ENST00000475268 ; SEC61A2-006; intron 1

  ENST00000298428 ; SEC61A2-009; intron 1

  ENST00000495368 ; SEC61A2-007; intron 1

  ENST00000304267 ; SEC61A2-008; intron 1

  ENST00000472221 ; SEC61A2-012; intron 1

  ENST00000379020 ; SEC61A2-010; intron 1

  ENST00000379017 ; SEC61A2-001; intron 1

  ENST00000379033 ; SEC61A2-201; intron 1

  ENST00000379033 ; SEC61A2-201; intron 1

  ENST00000379020 ; SEC61A2-010; intron 1

  ENST00000379017 ; SEC61A2-001; intron 1

  ENST00000472221 ; SEC61A2-012; intron 1

  ENST00000379051 ; SEC61A2-011; intron 1

  ENST00000441368 ; SEC61A2-002; intron 1

  ENST00000475268 ; SEC61A2-006; intron 1

  ENST00000298428 ; SEC61A2-009; intron 1

  ENST00000495368 ; SEC61A2-007; intron 1

  ENST00000304267 ; SEC61A2-008; intron 1

  ENST00000379051 ; SEC61A2-011; intron 1

  ENST00000441368 ; SEC61A2-002; intron 1

  ENST00000475268 ; SEC61A2-006; intron 1

  ENST00000298428 ; SEC61A2-009; intron 1

  ENST00000495368 ; SEC61A2-007; intron 1

  ENST00000304267 ; SEC61A2-008; intron 1

  ENST00000472221 ; SEC61A2-012; intron 1

  ENST00000379020 ; SEC61A2-010; intron 1

  ENST00000379017 ; SEC61A2-001; intron 1

  ENST00000379033 ; SEC61A2-201; intron 1

Database links

• ENTREZGENE: 100616488;MIR548AK

Mature sequence hsa-miR-548ak

• Accession: MIMAT0019013
• Sequence: 5 - aaaaguaacugcgguuuuuga - 25
• Deep sequencing: 28 reads, 12 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-548ak
  • MIRDB:hsa-miR-548ak
  • TARGETMINER:hsa-miR-548ak

References

1. PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).