|
miRBase |
|
Stem-loop sequence hsa-mir-3689e |
|||||
| Accession | MI0016836 | ||||
| Description | Homo sapiens miR-3689e stem-loop | ||||
| Gene family | MIPF0001144; mir-3689 | ||||
| Stem-loop |
- g ug au g ug g a ggga g ug aucaug uucc ggag uaug u |||| | || |||||| |||| |||| |||| cccu c gc uagugu gagg ccuu gugc a u - gu cc g gu g u |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links |
|
||||
Mature sequence hsa-miR-3689e |
|
| Accession | MIMAT0019009 |
| Sequence |
7 - ugugauaucaugguuccuggga - 28 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|