|
miRBase |
|
Stem-loop sequence hsa-mir-548x-2 |
|||||
| Accession | MI0016833 | ||||
| Description | Homo sapiens miR-548x-2 stem-loop | ||||
| Gene family | MIPF0000317; mir-548 | ||||
| Stem-loop |
au - a ug c a gc caaauauuagguuggcac aaaguaauug g uuuugccauua a || |||||||||||||||||| |||||||||| | ||||||||||| ug guuuauaauccaaccgug uuucauuaac c aaaaugguaau a -g u c gu a g |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-548x-3p |
|
| Accession | MIMAT0015081 |
| Previous IDs | hsa-miR-548x |
| Sequence |
59 - uaaaaacugcaauuacuuuc - 78 |
| Deep sequencing | 19 reads, 4 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|