Stem-loop sequence hsa-mir-548x-2

AccessionMI0016833 (change log)
Symbol HGNC:MIR548X2
DescriptionHomo sapiens miR-548x-2 stem-loop
Gene family MIPF0000317; mir-548
Literature search

41 open access papers mention hsa-mir-548x-2
(141 sentences)

Stem-loop
   au  -                  a          ug c           a 
5'   gc caaauauuagguuggcac aaaguaauug  g uuuugccauua a
     || |||||||||||||||||| ||||||||||  | |||||||||||  
3'   ug guuuauaauccaaccgug uuucauuaac  c aaaaugguaau a
   -g  u                  c          gu a           g 
Get sequence
Deep sequencing
6775 reads, 8.94 reads per million, 123 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 65966330-65966429 [-]
intergenic
Database links

Mature sequence hsa-miR-548x-3p

Accession MIMAT0015081
Previous IDshsa-miR-548x
Sequence

59 - 

uaaaaacugcaauuacuuuc

 - 78

Get sequence
Deep sequencing4293 reads, 87 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).