|
miRBase |
|
Stem-loop sequence hsa-mir-4475 |
|||||
| Accession | MI0016827 | ||||
| Description | Homo sapiens miR-4475 stem-loop | ||||
| Stem-loop |
a uc g aaa u uc aaugagugu ugguucu ugac c || ||||||||| ||||||| |||| a ag uuacuuacg accaggg acug u a ua a --a a |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4475 |
|
| Accession | MIMAT0019002 |
| Sequence |
37 - caagggaccaagcauucauuau - 58 |
| Deep sequencing | 6 reads, 3 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|