Stem-loop sequence hsa-mir-4474

Accession

MI0016826

Description

Homo sapiens miR-4474 stem-loop

Stem-loop

u                           a      uau 
 ugccuaccuuguuagucucaugaucag cacaaa   g
 ||||||||||||||||||||||||||| ||||||    
 acggauggaacaaucggaguacugguc guguuu   g
c                           g      cuc 

Genome context

• Coordinates (GRCh37.p5): chr9: 20502263-20502340 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000051872 ; MLLT3-001; intron 2

  OTTHUMT00000051879 ; MLLT3-008; intron 2

  OTTHUMT00000051872 ; MLLT3-001; intron 2

  OTTHUMT00000051879 ; MLLT3-008; intron 2

  OTTHUMT00000051872 ; MLLT3-001; intron 2

  OTTHUMT00000051879 ; MLLT3-008; intron 2

  ENST00000380338 ; MLLT3-001; intron 2

  ENST00000475957 ; MLLT3-008; intron 2

  ENST00000429426 ; MLLT3-202; intron 2

  ENST00000540751 ; MLLT3-203; intron 2

  ENST00000355930 ; MLLT3-201; intron 2

  ENST00000380338 ; MLLT3-001; intron 2

  ENST00000475957 ; MLLT3-008; intron 2

  ENST00000429426 ; MLLT3-202; intron 2

  ENST00000540751 ; MLLT3-203; intron 2

  ENST00000355930 ; MLLT3-201; intron 2

  ENST00000380338 ; MLLT3-001; intron 2

  ENST00000475957 ; MLLT3-008; intron 2

  ENST00000429426 ; MLLT3-202; intron 2

  ENST00000355930 ; MLLT3-201; intron 2

Database links

• ENTREZGENE: 100616441;MIR4474

Mature sequence hsa-miR-4474-5p

• Accession: MIMAT0019234
• Sequence: 13 - uuagucucaugaucagacaca - 33
• Evidence: experimental; Solexa [2-3]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4474-5p
  • MIRDB:hsa-miR-4474-5p
  • TARGETMINER:hsa-miR-4474-5p

Mature sequence hsa-miR-4474-3p

• Accession: MIMAT0019001
• Sequence: 45 - uuguggcuggucaugaggcuaa - 66
• Evidence: experimental; Solexa [1-3]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4474-3p
  • MIRDB:hsa-miR-4474-3p
  • TARGETMINER:hsa-miR-4474-3p

References

1. PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3. PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Moqadam FA, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).