Stem-loop sequence hsa-mir-4473

Accession MI0016825
Description Homo sapiens miR-4473 stem-loop
Stem-loop 
a   -         c              a     --  -      a 
 agg aacagggga acuuguaauggaga cacua  ag cuaugg c
 ||| ||||||||| |||||||||||||| |||||  || ||||||  
 ucc uuguccccu ugaacauugccucu gugau  uc gguauc u
-   a         a              c     cg  a      g
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr9: 20411146-20411236 [-]
sense
OTTHUMT00000051875 ; MLLT3-004; intron 1
OTTHUMT00000051875 ; MLLT3-004; intron 1
OTTHUMT00000051875 ; MLLT3-004; intron 1
OTTHUMT00000051879 ; MLLT3-008; intron 3
OTTHUMT00000051879 ; MLLT3-008; intron 3
OTTHUMT00000051879 ; MLLT3-008; intron 3
OTTHUMT00000051872 ; MLLT3-001; intron 5
OTTHUMT00000051872 ; MLLT3-001; intron 5
OTTHUMT00000051872 ; MLLT3-001; intron 5
ENST00000468513 ; MLLT3-004; intron 1
ENST00000468513 ; MLLT3-004; intron 1
ENST00000468513 ; MLLT3-004; intron 1
ENST00000475957 ; MLLT3-008; intron 3
ENST00000475957 ; MLLT3-008; intron 3
ENST00000475957 ; MLLT3-008; intron 3
ENST00000380338 ; MLLT3-001; intron 5
ENST00000429426 ; MLLT3-202; intron 5
ENST00000540751 ; MLLT3-203; intron 5
ENST00000355930 ; MLLT3-201; intron 5
ENST00000380338 ; MLLT3-001; intron 5
ENST00000429426 ; MLLT3-202; intron 5
ENST00000540751 ; MLLT3-203; intron 5
ENST00000355930 ; MLLT3-201; intron 5
ENST00000380338 ; MLLT3-001; intron 5
ENST00000429426 ; MLLT3-202; intron 5
ENST00000355930 ; MLLT3-201; intron 5
Database links

Mature sequence hsa-miR-4473

Accession MIMAT0019000
Sequence

57 -  

cuagugcucuccguuacaagua

 - 78

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).