|
miRBase |
|
Stem-loop sequence hsa-mir-4470 |
|||||
| Accession | MI0016821 | ||||
| Description | Homo sapiens miR-4470 stem-loop | ||||
| Stem-loop |
c u u - u g gagcc cuuucggcuu cca guuuguc cg uccu ||||| |||||||||| ||| ||||||| || ||| u cucgg gagagccgaa ggu caaacgg gc aggu u - - g u a |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4470 |
|
| Accession | MIMAT0018997 |
| Sequence |
45 - uggcaaacguggaagccgaga - 65 |
| Deep sequencing | 5 reads, 2 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|