Stem-loop sequence hsa-mir-4469

Accession

MI0016820

Description

Homo sapiens miR-4469 stem-loop

Stem-loop

ccg    gga             u   uuu        c a 
   acgc   gagcggcucuagg ggg   ggcggcgg g g
   ||||   ||||||||||||| |||   |||||||| |  
   ugcg   cucgcugggaucu ccc   ucgccgcc c g
-ag    agg             -   ---        a a 

Deep sequencing

10 reads, 6 experiments

Genome context

• Coordinates (GRCh37.p5): chr8: 42751340-42751418 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000383165 ; RNF170-005; intron 1

  OTTHUMT00000383166 ; RNF170-001; intron 1

  OTTHUMT00000383167 ; RNF170-004; intron 1

  OTTHUMT00000383168 ; RNF170-003; intron 1

  OTTHUMT00000383169 ; RNF170-002; intron 1

  OTTHUMT00000383170 ; RNF170-007; intron 1

  OTTHUMT00000383171 ; RNF170-006; intron 1

  OTTHUMT00000383165 ; RNF170-005; intron 1

  OTTHUMT00000383166 ; RNF170-001; intron 1

  OTTHUMT00000383167 ; RNF170-004; intron 1

  OTTHUMT00000383168 ; RNF170-003; intron 1

  OTTHUMT00000383169 ; RNF170-002; intron 1

  OTTHUMT00000383170 ; RNF170-007; intron 1

  OTTHUMT00000383171 ; RNF170-006; intron 1

  OTTHUMT00000383165 ; RNF170-005; intron 1

  OTTHUMT00000383166 ; RNF170-001; intron 1

  OTTHUMT00000383167 ; RNF170-004; intron 1

  OTTHUMT00000383168 ; RNF170-003; intron 1

  OTTHUMT00000383169 ; RNF170-002; intron 1

  OTTHUMT00000383170 ; RNF170-007; intron 1

  OTTHUMT00000383171 ; RNF170-006; intron 1

  ENST00000319104 ; RNF170-005; intron 1

  ENST00000527424 ; RNF170-001; intron 1

  ENST00000240159 ; RNF170-004; intron 1

  ENST00000526349 ; RNF170-003; intron 1

  ENST00000528318 ; RNF170-002; intron 1

  ENST00000531440 ; RNF170-007; intron 1

  ENST00000524954 ; RNF170-006; intron 1

  ENST00000534961 ; RNF170-202; intron 1

  ENST00000319073 ; RNF170-201; intron 1

  ENST00000319104 ; RNF170-005; intron 1

  ENST00000527424 ; RNF170-001; intron 1

  ENST00000240159 ; RNF170-004; intron 1

  ENST00000526349 ; RNF170-003; intron 1

  ENST00000528318 ; RNF170-002; intron 1

  ENST00000531440 ; RNF170-007; intron 1

  ENST00000524954 ; RNF170-006; intron 1

  ENST00000534961 ; RNF170-202; intron 1

  ENST00000319073 ; RNF170-201; intron 1

  ENST00000319104 ; RNF170-005; intron 1

  ENST00000527424 ; RNF170-001; intron 1

  ENST00000240159 ; RNF170-004; intron 1

  ENST00000526349 ; RNF170-003; intron 1

  ENST00000528318 ; RNF170-002; intron 1

  ENST00000531440 ; RNF170-007; intron 1

  ENST00000524954 ; RNF170-006; intron 1

  ENST00000534961 ; RNF170-202; intron 1

  ENST00000319073 ; RNF170-201; intron 1

Database links

• ENTREZGENE: 100616115;MIR4469

Mature sequence hsa-miR-4469

• Accession: MIMAT0018996
• Sequence: 52 - gcucccucuagggucgcucgga - 73
• Deep sequencing: 7 reads, 3 experiments
• Evidence: experimental; Solexa [1-2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4469
  • MIRDB:hsa-miR-4469
  • TARGETMINER:hsa-miR-4469

References

1. PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).