Stem-loop sequence hsa-mir-4467

Accession MI0016818
Description Homo sapiens miR-4467 stem-loop
Stem-loop 
-u  u         agu  u     u  cuuu 
  gg ggcggcggu   ua gggcu cu    c
  || |||||||||   || ||||| ||     
  cc ccgccgccg   gu cccga ga    u
uc  u         --g  c     c  ccac
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr7: 102111916-102111978 [+]
sense
OTTHUMT00000349501 ; LRWD1-009; intron 2
OTTHUMT00000349501 ; LRWD1-009; intron 2
OTTHUMT00000349501 ; LRWD1-009; intron 2
OTTHUMT00000349500 ; LRWD1-008; intron 3
OTTHUMT00000349500 ; LRWD1-008; intron 3
OTTHUMT00000349500 ; LRWD1-008; intron 3
OTTHUMT00000349494 ; LRWD1-002; exon 7
OTTHUMT00000349494 ; LRWD1-002; exon 7
OTTHUMT00000349494 ; LRWD1-002; exon 7
OTTHUMT00000349493 ; LRWD1-001; intron 11
OTTHUMT00000349493 ; LRWD1-001; intron 11
OTTHUMT00000349493 ; LRWD1-001; intron 11
ENST00000468175 ; LRWD1-009; intron 2
ENST00000468175 ; LRWD1-009; intron 2
ENST00000468175 ; LRWD1-009; intron 2
ENST00000488689 ; LRWD1-008; intron 3
ENST00000488689 ; LRWD1-008; intron 3
ENST00000488689 ; LRWD1-008; intron 3
ENST00000473880 ; LRWD1-002; exon 7
ENST00000473880 ; LRWD1-002; exon 7
ENST00000473880 ; LRWD1-002; exon 7
ENST00000292616 ; LRWD1-001; intron 11
ENST00000292616 ; LRWD1-001; intron 11
ENST00000292616 ; LRWD1-001; intron 11
Clustered miRNAs
< 10kb from hsa-mir-4467
hsa-mir-5090 chr7: 102106189-102106273 [+]
hsa-mir-4467 chr7: 102111916-102111978 [+]
Database links

Mature sequence hsa-miR-4467

Accession MIMAT0018994
Sequence

4 -  

uggcggcgguaguuaugggcuu

 - 25

Get sequence
Evidence experimental; Solexa [1-2]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).