|
miRBase |
|
Stem-loop sequence hsa-mir-4467 |
||||||
| Accession | MI0016818 | |||||
| Description | Homo sapiens miR-4467 stem-loop | |||||
| Stem-loop |
-u u agu u u cuuu gg ggcggcggu ua gggcu cu c || ||||||||| || ||||| || cc ccgccgccg gu cccga ga u uc u --g c c ccac |
|||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
| Database links |
|
|||||
Mature sequence hsa-miR-4467 |
|
| Accession | MIMAT0018994 |
| Sequence |
4 - uggcggcgguaguuaugggcuu - 25 |
| Evidence | experimental; Solexa [1-2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|
| 2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|