|
miRBase |
|
Stem-loop sequence hsa-mir-548aj-1 |
|||||
| Accession | MI0016814 | ||||
| Description | Homo sapiens miR-548aj-1 stem-loop | ||||
| Gene family | MIPF0000317; mir-548 | ||||
| Stem-loop |
a g a a uugguguaaaaguaauugcag uu ugccauua a ||||||||||||||||||||| || |||||||| aaucacauuuucauuaacguc aa augguaau a c a a g |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-548aj-3p |
|
| Accession | MIMAT0018990 |
| Previous IDs | hsa-miR-548aj |
| Sequence |
45 - uaaaaacugcaauuacuuuua - 65 |
| Deep sequencing | 24 reads, 8 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|