|
miRBase |
|
Stem-loop sequence hsa-mir-3135b |
|||||
| Accession | MI0016809 | ||||
| Description | Homo sapiens miR-3135b stem-loop | ||||
| Gene family | MIPF0001219; mir-3135 | ||||
| Stem-loop |
u cu ag -- u - uc gcccagg gg cgag ugcagugg gc ag a ||||||| || |||| |||||||| || || cgggucc uc gcuc acgucacu cg uc g u -- aa cg - a cu |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-3135b |
|
| Accession | MIMAT0018985 |
| Sequence |
7 - ggcuggagcgagugcaguggug - 28 |
| Deep sequencing | 8 reads, 5 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|