Stem-loop sequence hsa-mir-378h

Accession MI0016808
Description Homo sapiens miR-378h stem-loop
Stem-loop 
a   gaac     a  ug u       -------    ---u    c 
 cag    acugg cu  g gucagau       ggga    gagc c
 |||    ||||| ||  | |||||||       ||||    ||||  
 guc    ugauc ga  u uagucua       uccu    cucg u
g   --ac     -  gu c       acgacga    uugu    g
Get sequence
Deep sequencing
67603 reads, 24 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr5: 154209018-154209100 [+]
antisense
OTTHUMT00000377438 ; C5orf4-011; intron 1
OTTHUMT00000377438 ; C5orf4-011; intron 1
OTTHUMT00000377438 ; C5orf4-011; intron 1
OTTHUMT00000377435 ; C5orf4-016; intron 2
OTTHUMT00000377436 ; C5orf4-010; intron 2
OTTHUMT00000377435 ; C5orf4-016; intron 2
OTTHUMT00000377436 ; C5orf4-010; intron 2
OTTHUMT00000377435 ; C5orf4-016; intron 2
OTTHUMT00000377436 ; C5orf4-010; intron 2
OTTHUMT00000377433 ; C5orf4-013; intron 3
OTTHUMT00000377434 ; C5orf4-012; intron 3
OTTHUMT00000377433 ; C5orf4-013; intron 3
OTTHUMT00000377434 ; C5orf4-012; intron 3
OTTHUMT00000377433 ; C5orf4-013; intron 3
OTTHUMT00000377434 ; C5orf4-012; intron 3
OTTHUMT00000377432 ; C5orf4-002; intron 4
OTTHUMT00000377439 ; C5orf4-007; intron 4
OTTHUMT00000377440 ; C5orf4-015; intron 4
OTTHUMT00000377432 ; C5orf4-002; intron 4
OTTHUMT00000377439 ; C5orf4-007; intron 4
OTTHUMT00000377440 ; C5orf4-015; intron 4
OTTHUMT00000377432 ; C5orf4-002; intron 4
OTTHUMT00000377439 ; C5orf4-007; intron 4
OTTHUMT00000377440 ; C5orf4-015; intron 4
OTTHUMT00000377429 ; C5orf4-001; intron 5
OTTHUMT00000377430 ; C5orf4-004; intron 5
OTTHUMT00000377437 ; C5orf4-008; intron 5
OTTHUMT00000377441 ; C5orf4-014; intron 5
OTTHUMT00000377429 ; C5orf4-001; intron 5
OTTHUMT00000377430 ; C5orf4-004; intron 5
OTTHUMT00000377437 ; C5orf4-008; intron 5
OTTHUMT00000377441 ; C5orf4-014; intron 5
OTTHUMT00000377429 ; C5orf4-001; intron 5
OTTHUMT00000377430 ; C5orf4-004; intron 5
OTTHUMT00000377437 ; C5orf4-008; intron 5
OTTHUMT00000377441 ; C5orf4-014; intron 5
ENST00000519258 ; C5orf4-011; intron 1
ENST00000519258 ; C5orf4-011; intron 1
ENST00000519258 ; C5orf4-011; intron 1
ENST00000524363 ; C5orf4-016; intron 2
ENST00000522825 ; C5orf4-010; intron 2
ENST00000524363 ; C5orf4-016; intron 2
ENST00000522825 ; C5orf4-010; intron 2
ENST00000524363 ; C5orf4-016; intron 2
ENST00000522825 ; C5orf4-010; intron 2
ENST00000520581 ; C5orf4-013; intron 3
ENST00000521518 ; C5orf4-012; intron 3
ENST00000520581 ; C5orf4-013; intron 3
ENST00000521518 ; C5orf4-012; intron 3
ENST00000520581 ; C5orf4-013; intron 3
ENST00000521518 ; C5orf4-012; intron 3
ENST00000517938 ; C5orf4-002; intron 4
ENST00000523997 ; C5orf4-007; intron 4
ENST00000518651 ; C5orf4-015; intron 4
ENST00000517938 ; C5orf4-002; intron 4
ENST00000523997 ; C5orf4-007; intron 4
ENST00000518651 ; C5orf4-015; intron 4
ENST00000517938 ; C5orf4-002; intron 4
ENST00000523997 ; C5orf4-007; intron 4
ENST00000518651 ; C5orf4-015; intron 4
ENST00000326080 ; C5orf4-001; intron 5
ENST00000423554 ; C5orf4-004; intron 5
ENST00000519501 ; C5orf4-008; intron 5
ENST00000520968 ; C5orf4-014; intron 5
ENST00000326080 ; C5orf4-001; intron 5
ENST00000423554 ; C5orf4-004; intron 5
ENST00000519501 ; C5orf4-008; intron 5
ENST00000520968 ; C5orf4-014; intron 5
ENST00000326080 ; C5orf4-001; intron 5
ENST00000423554 ; C5orf4-004; intron 5
ENST00000519501 ; C5orf4-008; intron 5
ENST00000520968 ; C5orf4-014; intron 5
Database links

Mature sequence hsa-miR-378h

Accession MIMAT0018984
Sequence

9 -  

acuggacuuggugucagaugg

 - 29

Get sequence
Deep sequencing 67603 reads, 24 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).