Stem-loop sequence hsa-mir-4461

Accession

MI0016807

Description

Homo sapiens miR-4461 stem-loop

Stem-loop

g           guua g   g      ---agg   ua 
 aguaggcuuag    u uac uagucu      cca  c
 |||||||||||    | ||| ||||||      |||  g
 ucauccggauc    g aug aucaga      ggu  u
g           ---g g   -      guuaga   ug 

Deep sequencing

204 reads, 17 experiments

Genome context

• Coordinates (GRCh37.p5): chr5: 134263729-134263802 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000371577 ; PCBD2-001; intron 2

  OTTHUMT00000371578 ; PCBD2-002; intron 2

  OTTHUMT00000371580 ; PCBD2-004; intron 2

  OTTHUMT00000371581 ; PCBD2-005; intron 2

  OTTHUMT00000371577 ; PCBD2-001; intron 2

  OTTHUMT00000371578 ; PCBD2-002; intron 2

  OTTHUMT00000371580 ; PCBD2-004; intron 2

  OTTHUMT00000371581 ; PCBD2-005; intron 2

  OTTHUMT00000371577 ; PCBD2-001; intron 2

  OTTHUMT00000371578 ; PCBD2-002; intron 2

  OTTHUMT00000371580 ; PCBD2-004; intron 2

  OTTHUMT00000371581 ; PCBD2-005; intron 2

  ENST00000254908 ; PCBD2-001; intron 2

  ENST00000512783 ; PCBD2-002; intron 2

  ENST00000504352 ; PCBD2-005; intron 2

  ENST00000510013 ; PCBD2-004; intron 2

  ENST00000254908 ; PCBD2-001; intron 2

  ENST00000512783 ; PCBD2-002; intron 2

  ENST00000504352 ; PCBD2-005; intron 2

  ENST00000510013 ; PCBD2-004; intron 2

  ENST00000254908 ; PCBD2-001; intron 2

  ENST00000512783 ; PCBD2-002; intron 2

  ENST00000504352 ; PCBD2-005; intron 2

  ENST00000510013 ; PCBD2-004; intron 2

  antisense

  OTTHUMT00000371595 ; CTB-36O1.4-001; exon 1

  OTTHUMT00000371595 ; CTB-36O1.4-001; exon 1

  OTTHUMT00000371595 ; CTB-36O1.4-001; exon 1

  ENST00000454092 ; CTB-36O1.4-001; exon 1

  ENST00000454092 ; MIR4461-001; exon 1

  ENST00000454092 ; MIR4461-001; exon 1

Database links

• ENTREZGENE: 100616209;MIR4461

Mature sequence hsa-miR-4461

• Accession: MIMAT0018983
• Sequence: 46 - gauugagacuaguagggcuaggc - 68
• Deep sequencing: 203 reads, 16 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4461
  • MIRDB:hsa-miR-4461
  • TARGETMINER:hsa-miR-4461

References

1. PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).